Description :
From Genome Similarity Track
Location :
Scaffold_84:89844- 95567
Transcript NameFunction/comments
Phyci_83206Amino Acid-Polyamine-Organocation (APC) Family
Phyci_95133DEAD/DEAH box RNA helicase, putative

Sequence
5723 bases(100 bases per row)
TACAAGACGCAGCTGCCGACCATAAGCGCATCCGCTGGACTGCCATATTCTCTCTctcctcctcctcctcctcctcTCGACCGCCGCCATGGACCGCTTC
CTGCAGGCGGCAGGCCGCGTGAAGCCTCTGTCGCGCTGCGAGCTGGGGCCCAGCTCATTGAAGCAGTGCCTGACGCTCACGGACCTGGTGGCATATGGTG
TGGGCTGCTCCGTGGGCGCCGGCGCCTACTCGCTCGTGGGCGTGGGCGCGCAGATCGCGGGCCCCAGCATCTCGCTGTCCTTCCTCGTGAGCGGCATCGC
CTGCATCTTCACGTCGCTCACGTACTCGGAGTTCGCAGCGCGTGTGCCTGTACGTTTTGCGACCTTTGCGGGGATCGCAGTGGATGTGAGGCTGAAAGTG
TGTGTGGGTGAAGGTCACGGGCTCGGCGTACACCTTCGTGTACATCACCTTCGGTGAGCTGGCGGCGTGGCTCATCGGCTGGAACCTGACGCTGGGCTAC
GGCATCTCGGCTGGTAAACGTTGCTGTCGACGGGGGTGAATGTGCTGCAGGATGGAAGAAGACTGACAGTGCGTTTGCTGGTGGTTGCAGCTGGAATCGC
GCGTAGCTGGGCGTCGTACGCGCACTTGTTCTTGCAACACTTCGGACTGCACCTCCCGCGTTGGCTTGTGCAAGCAGAGTTTCTCGGCATGTCGTGTAGC
ATCATGGCGGCGTTTCTTATCATTTGCTGCACGTTCATCCTTCTTGCTGGCGTTCATGTACGAGCTTAAAACTCGATGGAGAGGGTGACGATGCGGATGT
GGAAGTACTGATGGTGGGGGTTGTGTTACGGTGCAATTTTGCTAGGAATCTGCCAAGTTTAATGCCTTCGTGACGCTGCTGAACATCTCGGTGCTGCTCT
TCGTGGTTGCATTTGGGAGCACACAAGTGGATACAACGTACTGGGAGCCATTCATGCCTGCCGGGATCCACGGCGTCATGACGGGTGCTGGAGTGGTCTT
CTTCGCGTACTTGGGCTTTGACATGGTCGCGTGCCTTGCCGAGGAGGTGCACGAGCCTCAGCGCACGCTGCCAAAGGGTATCATTGGCTCGCTCATGATC
TCGATGACCATCTACGTTGGTGTCTCGCTTGTTGTGACCGGTATGGCGCCCGTCGATACTCTGGGTAGCGAAGTTCCGCTTGTAAATGCGTTCATGTTCC
ATGACGCACCGTGGGCTGGACGCGTCGTGTCGTTCGGCTCCATTTTCGGGCTTACCACTGCCGCTTTTACCTGCCTAATGGGCCAGCCGCGCATTTTCTA
CCAGATGGCCAAGGACGGTTTGCTGCCATCGCTCTTTGCCGAGCTGCACTACCGGACGCACGTTCCTGTGGCCAGCACTGTCTTCACGGGCATCCTGGTT
GCGTCCATAGCATTGGTGTTCGAACTCGACTTCCTGGCCAATGTAATATCGTGCGGAACATTGCAAGTCTTCACTTTTGTGAACGCTGGTGTGTTGCTTT
TGCGCATGCGCCCAAGTCTCGGCGGCGCTGGTGTCGTCCACCGTGTCCTCCTGTACGTGGTTTCGTGTTTTGCTTTGTCGCTGTCATTTGTCTTCGATCT
TCCATGGACGATTCAAGGCGCGTTCGCTATGATGGTGATTGCCTCGTTCGTCTACATCTATCGACTCGGAAAACTCAGGTTCGCCAATGCTTCTCTTTTT
GCGAATCGATACTCCCAACTAACACGAATATTGTGTTGCTACACCTAAACAGTGACCTGACTACGTCATTTCAGTGCCCGTTGGTGCCGTTGGTGCCGTG
CGCGGGTATCCTTGCCAATGTCTACATGGTGGCAAGTATCCCCGGCGAGGGATGGTACGTGAATTTACTTGTAGCTTTATCGTGGGCTGTCGTGGGCTGT
GAAGCTAACCTTATGGTGTTTGCAGGATCGGTGTGCTTATCTGGCTGGGTGCAGGGGTTATCTTGTACATGTGCTACGGAATTCGCCACAGCATGCTGAA
CGATGCGGCCCTGCTTCACCCTCTACTTTGAATGCACCACACTGTAGTAGACTAGATTGCATGCATACAAGACCACGTCTTTTTCAGGCGGTGCGACTCT
CACCGTGAGAGCACTAAATGTATCCATGTAACTTCACTTCAACATCTCCGACCAATCACAGATGCTATATCTATTTTCAGTCATATGGCTACATATCTAA
TTGGGCATTTGCAGAAGACACGACATCATGCATACCGTACCAGGGTCGACGCCCTCAGCATTGGAGTGTCTTCTGCCGTTCCAGCTACCCCGGTCTGACA
ACAACGATGGGGGCGATTCAACTGACAGATACGATCGGATCAGCCTCGAAAACCCCTCGACGAGGTCTCGCGAAGACGACGACAAAATGCTCGAGCTATA
TCGCCAGGCGGTGCCACTCGTCCAACCGCACTCAACAGCGGCGATCAAAACTATAGGAAAAATTGTACGTGATCGTGAACTAGTCAAGCGCATGCTGCAG
CGCCCACAACCATACGCCAAACAGCTCGATCGACGTCCCGTTACGCACGACAGTCCCACACTTAAAACGACACCACTGTCAGCACAATCGTCAGAGCTAA
CTAGCGATAACCAAAGCAACAGTCATCGTCACATTATGTTTATGGCAGCGTGCGAAAAGCTCATGGTGACCTTCGATCCGCAAGTGCGCCAAACCCGTCG
ACTGAAGCTTGTGCAGATTAAACCGTTGCTACGTTTTCATGGCTTGGAGGTCAGCGACGCAGCTTTTCGTCGATGGGAGCAACGGTTGCCACCAACAAGT
ACTTCTGGGGCGACAACGATGGCAGGGCCTATGGTCTCGGTGAGCGACTTTGTTCAAGGGTGTCAGCTTTGGTTTACCAAAACATTCCTTATCGAGCATG
CACGGGATCTTACAATCTGGCAGAAACAGCAGAAAGCAATGAAAGCAGGCAAAGGGAAGAACAGGAAGCTATCGCCCCTATATTACGAACATCTGCAGTC
GCCTGCGCAAGCTACCCAGCCACCATTTGATCGGCTCGCCCACGAAAGCGCCGCTACGAGCTCATTTTCGTACGAGGCTTATGCTCGCCATCCACCTCCA
CGAGCCCCTACGCTGAACGCGTCTGCTTCTGCTCCAGCGCTATTGAACGCAAAGTATTGCTCGCACAACAAGCTTGACCCCGCCACGCTAGCTGCTGTAA
GCAAACTCAATAGTTCCAAACAGCAGCAACATCGGAAGAAGAAGGAAGCTGAAATGCTAGCTCGACAAGCAAGGCAGCAGAGCACTGAGATAGCGCGTGC
GTTCACTGCAAGTGTAGCTATGATCTCGCGTCACGTACACAACGAAGAAGTGCGTGATCACCGCGACAATGAGCTTGATATGCAAATTGCTCGCACCGAC
CAGATTCGTCACTGGAACCAACGCCACAAAGCGCATTGTCGGGCTGTTGACCAAGACGTGCGAGCACAAAGGGCTCGAGAAGTATGTGCCATGAAGGCTT
TAGCCGAAGAAGAGCTCCTCTTAACCCGCGACTTTCGAGCACTCCGAGAGGAGGTGGTGCGCCGTAACAAACCCCTTTTCGCGATGTCATCCTCTACGAG
CACGATATTCCCTGCCCCACCTGAAATTCTGGCAGCACGCGCCACGGCCAGCACCCAGGCAGACCATAGACGGCTTGCTCGTGTGGAACGCGAGCATGCT
GAGCATATGCGCAGTCTGCAGCTTCTAGACTACGTGTACGATCGGAAGAGGATGATGGCCGATGCGCTGCAACCTCGTGCTGATTCCGCTCTGGTAGAAG
TGGACGTGCCTGATGAAGAGCTCCCCGCGGACCGCGTGGTACAGCTAGCAGGCGATGAACTTTGGCAGCAGATCGTCCAGCTGCACGAGCAAGGAGACAC
CGACAGTCTCGCTTTGCTGGTGCCTCCTACCAACTCACCGCCCGCAGCTCTGCGCTACTTCGGCACTAGCCGACCCATATCGCTACCAGCCTTCGCTTCA
ACTGTCGACCGCAACCTTCAATAGCCCAAGCACACAACAAGAAACATCGTAAACGAAGCAAAAACGTGAATCTATTTGGCAAGCAAAGCAAAGCAAGCTC
CGTGATACCTGGCGCCAAGGCTCTGGCCTCGACGGACAGCGCAAACATGGCTCTAAGCTATTTAATGAGTAGCGCCCTTGCTCATCTTGTACTTCTTCTT
GGCAATCGTTTTCGGGTTGAAGTGGCCCTTGCGGTGCTGCTTCTTCCATTTCTGACGACCAGCAGTACTCTTACCCACGCCCGAGTTACCATAGCTGATA
CGATCCTCAACAGTCTGCTTCTTGTCGTCGTCGGCATCAGGAGCCACGAACGTGTGCAACGGGTCGTTGTCCGTACGGCGCTTGCCGTCTGCGAGGCGCT
GCCGCTTGTTGTGCTTGTTGTGTTTCTTCTTGGTGCGCCCTGGTGCCGGTGGCTGCAGCTCGATAGGAACAAGGTAGTCCGGGATAGTCGCCAAATGGGG
CTGAACCGGCGCCGAGCCAACCACCTTGTCGTGTTCAAGCATGTTCAGATCGCGTGGGTTAGCCTCGAAGTGTGCCGCCAAGCGCTCCGAGTTAAGCATT
TCCTTCTTGACATCTGCCAGTTGTGCTTCGCGCACAGCCACACGCGTGACAGCACGACGGACATCTTCCACCCGGTACCGGAAGCAATCGATCTCCTTGA
GGTCAAAGGCAAGCTCGGCAGGCTGCGCCAAGACATCATTTGACTCAGAACGAACAGCCTGCTGCTTCGCCTGGACACGCTTCAGCGCACGTTCTTCCTT
GGGGTCATCCTTGGACACCAGAGACAGCGCCGTACCGGAGGCACCACCACGCGCCGTACGTCCGATACGGTGGGTGTATGCACGCACACTTTTCGGGAAA
TCCACGTTAATAACAAACTGCACACCGCGGAAATCAACGCCGCGCGACACACCGTAGCCTTCGTCATCAGCACGTCCACGTTTGGACCCCACCGTCTTTT
TATCTTTCTTCTGCtcgtcgtcatcaccctcctcgtcctcaggagcttcgtcgtcatcactgtccatggcttcgtcatcctccttctcgctgtcttcttc
cttgtcgctatcgtcatccttttcctcgtcttcctcgacagcttccgactcggcgtcagacttctgaccgtcttcttcctcctcgtcttcgtctttgtct
tccccatcatcctctccatcctcgccctcttcctcatcgtcttcatcttcgtcctcatcgcccacttcatcgcgatccacactgtcgtcCGTAGCGATAA
GGTAGTCAAACAGACCACGGTTGAACTCCTCAATAATGTGCTGACGAGAGTTGTGGGGGAGCTTCGCGTTAAGCACTGCGCTCTTAATCACGAACTGCTC
GAAGAAAAGCTTGAGTCGGTACGCCGCATCGGTCGAGTTCACGAAGAAAATCACCTTGCCGCTCACCACGCCAAGTCGCAACAGGGCGTACAGCAGCAGG
TCCTTGTCGGCGGGCTTCACCGGCAGGTAGAACTGCTGCAGCTTGCCGTCCGTAGCGCCCTCCTCGAGCTTCACCACAGCAGGGTTATGCAGCACAGAGC
GCTTGAGCTTCTCGAGCTCGGGGCTGAGCGTCGCCGACATGCAGAACGTCTGGCAGGCCTTCGGCAGCGCGTTGAAAATGGTGCGGATGTCTTCTCCGTA
CCCGAAGGAAAGCACCAGATCGG