Description :
From Genome Similarity Track
Location :
Scaffold_109:89838- 93491
Transcript NameFunction/comments
Physo_142161hypothetical protein

Sequence
3653 bases(100 bases per row)
GGGGATGCTTAACGAATACTCTGTAATGCATTAGTTCTATTAGACTTTGAGTTATGGAGCGACAAGGAGGCTGGCGGCAATCATTCTTGCTGTGTTCACA
ATTATTGCAGTTTGTGTCTATTGTATTCTTGACTTACTATTATCTACAGCGTTATTTCACGTTAAACACCGATTGTCGCCGACAAACCGGAATCGTGGTG
TGCGGAAACTTATAAAATTATCATCTGGTACGGATTCACTAGAAAAATGAGAAGTTCCCGGCTAAAAAGCTGATAAGTTCCCGGCAAAAATGCTGATACA
TGTCTTTTTGATGTATACTGCGTTGTTAGTGGTGTGGTCGACTTGAGATGAATAATATCAATACATGTTGAGGAATCATTATGTCCGAGAGAGAGAGAGA
GAGCTGCAAACTCGAAAAGGAAGTCACGGAAAGGTCATATTGATGTCAAACCTGACTCAAACCTGATGGTAAAAAATGCTCTACCGAGCTCTTTTATGAA
AGTGAAGGAGAGGTATAATCTCCAGCAGAGAGATAAAGTATGCTGCCTACGTTCTCACCACTTTCAGTGGTACTTTGTATGTCATTCCTATGAGGCGAAT
TTTAAATGAGGGGCATATGGTTAGTGCTGGCCGTGAAGGGTGTCTCATGAAATAGTTTTCGAAGGGGTATTTCGTTAGGTTTCCCTAAGACATTAATAAA
ATAAGCACTGATCCAACCTCTTGCAAGTACAGAGCCTCAATCTTAAACAAAAAGCGGAACAAAGACTAAAAGGCGCAATACACGTCAACTCGGGGATACC
TACTGGCCACGAAAGGATTGCTAATGCAAGTGTTGCTAAAGCGCTGAGAAATAAACATTATTCTTGTTGTCCTGTTGCTACCCAATTGCCAACCGTTATT
CGTTTTCAAAAGTACAACTATTTTCAGCGTACTTTTGTGCGGAGGTAAGATTAACCGAGAGTTCCAGGGCTCGGCAACGGTGTAGTAGTGCATTAAAGGA
AAATGTCAGGTTATCAAAATCGATCAGCAGAAGATTAGACAGCGGAGGACCGCAAAACCGACCAAGCAATTGATGCAGCTTGCTATACAAAGCAGCTACG
TCAAAGTACACAACAGTTACAGATAAAGCAAATCGAACAGTCTATCAACACTGGCGGATAGCTCCAAGAAAGCACTTCAAACGATGTAGAACCTTCAAAA
TGTCTCCCATATTCTGTCAGTGATCGCCAGGATATAGGAATATTTCGGAAATTCCCGTATTGGTAGAGGTCTGCGCATGAGGCATGCGTGTGAAGTGTTG
ATACACAATCTCGATACACTCACTTACTCCTAGCACTACAGGTCAACTAAATGAAGTTTGATGACAAATTAAATGATTTCGAAAAAATCGACAGCCAGTG
GTTCGGCGCGCGAAACGGCACGAGATGAGATAGTAGAAACGAAAGCGACAGCAAGGATGTGCCCTGTAGGAGTTCATTTTACTCTAGTTCATTTTACTCT
GCTGTCACTTTGTTCTCTTCCCTTCTCTTACCAAAGCTTGTCACAAATGATAGCCTAATATATTAGAGCGATATTAGAGCGCTAGCACTGACCCGCCCCT
AGGGCACTGACCATAGGTATCGGCGGGGTTTCGCTCTCCGACTCGTAGTTAGACAACGTACACATCACACGTTCTCGATATGCTTGAAGCTGGCGGCGCT
GCTTTCCAAGTCCGCGTTCAGGCCCGCTGCCTCCGCCATGCCCGTGGCGCTGGGGCCCGACCGAAACCACTCGAGAGCGTACTCCTTGTTCTTCTGGAAG
CACAGGAACGCCTCCACCATGGCTGGGCTGTCGGCCAGTGCAGCCTCGCGCGCAGGACCTTCCGTGCGCACGAGCACGCTGTAGACGTTGCGCCGAACAG
TCTCTCCACTAGAAGACGCCGCTGGCAGCGACAGCACCATCTCGGCGTAAGGCGCGATGAGAGGGAAGCGCAGCTGGTTCGTCTTCCACCACGCGAGCGG
GTCCACGTTGCGCTCCGACACTGGGAGGCTCAAGAAGGCGCTCAGCTCCTTCTCCCACGTCGCGATCATCTCGTTCTCGCCCTGCAGAGACGACTTGGAA
GACTCGGACGGGAGGTGCGACAGCAGATCATCGTCTTCGTCATCAGGCAGCGCCACTTCGTTGCTCGTTGGACTGGCCGAGCCCTTACCTAGGTTCACAT
AGCCTGCAGACTCCGCCAGCGCCGATGAGGCCTGTGAGTCGCCATCGGACGTGAACATCCGACGCAGAAAATCCTTGCCGACGTCGCACTCGGTCTTCGG
AGAGAGATAGCAGTACTCACGGTTCTTGTAGCGTGGGTCGAATAACGTTGCAGCGTAGCAGACCGGCGGAAGTGTGGCGAACTCCTCGCGCAGCTTCTTG
GCGAGGGTCTCGAAGAAGCGTCTCCATGTCGCCGGCTCCAAATGGGCCGGTACACTCTCGGCCGCCGAGTTCGCTTGCTTCTGAGCATACGTGACGAGCG
CCGCAGCGATGGTTGAAATACTGGAGATGCCGCTCTTGTTCACTTCCTTGTCGCTGCCGGTTTTCTTGTTCTTTTCCCCCTCGAGCGCCTCCGAATACCT
CGCAAACGGCCGCAGCTTTTTCACTAACAGACTGATAAATTCCACCGTCGAGGCTGGAAGGTACTCGACCAGGTGTGCGTTCGCGATCTGCTCCAGCGTG
GGCAAGTGATCGACGAAATCGCGCAGGAACTCGTAGTAGGAGGTGGACTCCTGGTCATCAGGGGAGAGTTCCAGGTTGAACAGCGGGGATTTCCGGCCCA
GCGCGATCATCGCGTCCTCGTTCTCCGTCAGTCTGCCCACAAACTCCTCCACTTGGTTCACCACCACGGGGAACGCCTTGACGAAGACAGCCTGGGTCAA
GCAGACGCGTAAATGCTGCACGGCCGACGTCAGCAGCAACGTGCTCTGGGCCGCATCGGGCGACAACATCCGCCCGTCGAAGTTGATAGGCACGAACAGT
GACGGCAGGTCGGCCGTTGTGAGCTGCACCTTGGGCCCAAGGTGCAGCTCGTCCTTGACGCAGGCGATGACTTTGTCCTTAATGCCCAGTCGCTCCAGGT
ACGAGTCCAGAATGGCCTTGATGGTCTCCAGTCCTGCCGAATCCTCGAGCGGCGCGACCCCCACAGCAATGTCAAAGAGGCGGAAGTTCACACTGAAGTG
GATCTTCACGGCCAGATAGCGCGTGGGTTTGGGCTCCGTGGGCGGCGCCGGGTGCTGCCACACCTCGAGCGAAACGGCGACGCTCTTAGCTCGTGCCAGC
ACCATTTTGGTCGTCAAGAAGACGCTCTCCTGCAGCAGCAGGACGCTCTTGGCCAGCGCCTCCTCCGTGGGCAGCGGCAGCTTCTTCTCTCCGACCAACT
GGTTCACCATGTACTGCATGCCAGGCTTCGTGGTAAAGTTAAGGGGCAGGTTGTCCATGAGCGCCATGAGGGCCAAGTCCTGGGTGAACTGCTCGGCGCC
CACCTGCACCGACTGCACGCCGTAGGCAGAGCCCAGCGACTCGCGCTGCTCCTTGCTCATGGCTACACCGGGCGCTGCGAACGGGTACAAGGCAGCCACG
GCCGCGTCTCGCTTGAGCGCGGCCGAGAACATGCTGGGCGAGCCTCCAGCCGC