Description :
From Genome Similarity Track
Location :
Scaffold_16:89825- 125968
Transcript NameFunction/comments
Phyra_94360Hypothetical protein
Phyra_94361unnamed protein product
Phyra_42541phosphatidyl inositol kinase (PIK-G1)
Phyra_76075phosphatidyl inositol kinase (PIKG1) putative
Phyra_42543predicted protein
Phyra_76077AlNc14C82G5326
Phyra_76078Hypothetical protein
Phyra_76079PREDICTED: cysteine proteinase RD19a-like
Phyra_76080transmembrane protein, putative
Phyra_76081transmembrane protein, putative
Phyra_71385putative Ran-binding protein
Phyra_71386Holliday junction ATP-dependent DNA helicase ruvB

Sequence
36143 bases(100 bases per row)
GTGCCAGCAGCGCCATAAGCCAAATACATCGCATATGGACAGCCAACCAGCGCGTTAGTGCTGAAAAACTCTCCGTCGCGCTTTCTCCACCGTCATCTTC
CAGTTCGTAAAGAATCAAGGCGTCGATAATATGTGCACTCGCGTAGCAGACTACGGGTAACCAACTGCCATACACCACAACTTGGCTGGGGATAGCAAAG
AAGACACGTAGAGCGTGCTTCATTCTTGACGTATCCGTGCCGATCTTCTGACCAACATTTTTGTCGACAACGGCAAAACAGGCGACAAGCAGACACACCA
CTCGCACGACGACGTACAGTTGCCCGATAAAGCGCAGTGTTGATGCCAAAGAGCTCCATTCGAGGGCGTCAGTGTAGAGGACTTTGCCCTCGACACGCTC
ATCAAAAACCGCTATCGTCTTACAGACACGTGCGTCAGTGCATTGTCGAATCCGGTAGAGTGCCACAACATTGTAAATCTTGTGAGCAATCAAAACAGCC
CCACCCAATCTTGTCAACGGGTCCGATTCAGCCTCAACTAGCGTGACATCGAGCTTTTGACCATGTGCTAGTGTTGCTTGTAATGCTGCAGCACGCGATG
ACACAATCTCCCATAGTGCTTCGCTTTCGGTATCGTCGACGGGTAGAGCAGCAGCCCACGGTTTCTCGCAAAAGAGCGGCCGATCCAAGTCGTCCACGCA
CAAGTCGACTCCAGGATTTTTGGTGTCGAGATCGGTGAACGTTGTAACCCAAACGCTGAGCCAATACTTATGATCCAGCAAGTTGCGTGACAGAAAGCTG
GTGCTGCTACTCGCAGCAGTGGAACCAGAACCCGCGCTACTCGTACCGGTCCAGCGAGCTTTAGCACGAGCTGAGAAGCACACGCGTTGGGGCAGCGAAC
TTAGTTCGCCTCGTGCCATGATCGCGATGCCTTCTTCTGTTTGAGCCACATTCTTGTAGCTTGTAGTGCTTGGAGCATTGGCCGCCACCGCCTCGACAAG
GGTATCGAGCATGTTGAACACTGTTACTGCAGGCAGGGAATCGCCACAGTCGCTACTGTACGACGCGCCCACGGAATGAGCGCTTAGTAGGCACGTCGGC
CAGGATGAATCCAGCATTGGGGACCCCTCCAGCAGATCACGAACGGTGCGTAGTCCGTAGGAGCTTGGAGTGAACTTGTAGAGCGCAGTGGATACCTTTG
AGCTGCTGGCCGAGACTCCGTCTGTGGCCACCGTGCCATTTTGAAAGAGCGTTTGACTTGGTAGTGCCGTGGGTCCGTACACCGTGAAGACATTTGGCTC
GATCTGAACAAACGGAAGCGACGTCACGCTCGATCCCGCACGTGGCACATCGGAAACGAGCAGCGCGTACGCGAAGAGAGCCAGGATCACTCGGAGAGCG
GTGGATCGAGGCAGTCCCTCGACGAAGGTAGCCGTCTCGCGTGCACCGTCCGGATGCATCGCGTGCAGCAGCAGCGACGAGCGTTTGCGCTGCCAATTGT
TTTCGGTTGGTACAGCAGAGGCCGACGGCGCTCCGGATGGCTGGGCACCAGGTCCGGCGGGTGTCTTAGCTCGAGTGTCGCTGTTGAAATCCGGATTCGC
CTCGACGTCCTCAGTTTGGTCGTGCGGCGACATGCGCTTCTTGGACTGGTGCGGAGACTCGAGAGCACTGCCGATGCCCCCATCGCTAGTGGCCATGACG
GCGGATCCGAAGCTGCAAGTATTGGGAATGCCGACTGTTGCCCCTACTGCTGGATGGTCGGCGGTTTCGACAAAAGATGCCAGCTTCGCTTGTAATGTAT
GGCCATGTTTCTGCTGCAGGAGTCGGCATGAGGCCTGGCCCTTGATGTGAAGCTACTGCTGGAGACGGTTGTACCAAGTCACAATGGACTCGAGCCCCGA
AGGGCTTTTCGGTCCGACATGGCTACATCTCGAGACACTGTGTCCACGTATTTAGTGCAGTAGCGGATACACATGTACTTTGCCACCCACCACTTCCTTG
CTGAGTCACCCACTTCCAGCGGAGTCTCCAAGTTGGCGTCTCCGAGCTTTATCGGTTGCATGGCCTCCATGGTTAATGCCCCATAGTGACCGCATCTCCG
CTTCTCGCTTGAAGCTTACGCCACGCCTCCAATAGCCAAGTGCACCATTGCACCATGAAAATCCATCGCAGCGTGTGACTTGCAGCGGCCATGTGGGCGC
GGTATGGGTTCATTTTCGTCCAATCATGTCCCGAAATCGCGTCCCAGAGCCGGCATCTGCCCAGCCACTTACATTCCCGGACTTGCCATCGCTCGACCAA
CTTGCCGCCCGCCATGAGCATCGACTGGTCACTTGAGTGCTGCAACGACAAGCAGTTCCTGTCCATCTTCCTCATCATCTGCTACGCCGTCGCCATCTTC
AAACTGTGCGGCCATCGATAGGTGCTCCACCGAGCTGTTTCATAGTCTTCTAACCTCCTTCTCTTTCTCCCAGATGGCGCGTATCAATCCTCCACCCGTT
TAAAATCCTGTACGTAGCCATTGCTGCCGACGATTTGAGGGTTTCCTTATAGCTGACTGGGTTGTCGTGGCTGCAGAACGGTCTTCCTGCACGAATTGGG
GCATGCGACGGCTGCGTGGCTCACTTGCGGCAGCGTACGAGACCCCCGACCTAGTATGATATGAAACAATTGACCTGATGCGACTATTGCCGCTTTGCCC
ATAGGTTAAAGGAATGGAGGTGCACCCGGACGAGGGCGGTGTGACCAAGACTGTCGGCGGACTGCAGTGGGTCATCCTCCCAGCTGTACGTCGCTGTGGG
GAAATTGTGCTTTTGGCAATGTACTGACGTCGTCAATTGGTGGCAGGGGTACCTGGGATCGGCAGTGTGGGGCATGGCGCTGATGATTGCGAGCGCTGAC
AAGACTGCATCGGAGGTGGCAGCGGGCGTCCTCGTCTTCTTCCTGCTCATCTTCATCTTCTACGCGCACAACGGCTACCTGAGGATCCTAAATTTCTGCT
TCATCCTGCTGCTCGCGGGCTTGCTGGCACTCAACATTTGGACGACTTTCGACGCGCTGCAGTACGTGACGCTTTTCCTGGGCGTCATGAGCTGCCTCTT
CTCCGTGTACGACATTTGGGACGACCTCATTTCGCGACGAGTGAACGAGAGCGACGCGTCTGTCTTTGCCAAGATGACTCATACGTCGAGTCGCTGCTGG
GGGGTTATCTGGGGCATTATCGCGCTCGTCTCGCTCGTCGCTGCCGTTTATTTCAATTTGCTGGTTGCACAGGACTCTGGCGAGTCGATTACGAACATCT
CCGACGCCTCCACAGGCACGAAGATCGCCCTTGCCTGCGCCGTTATCATCGTGGCCCTCGCCGTGCTGCACACTGGATTCACGCGGAGATGTATGCTGCG
CAAGCGTGAAGGGTTCAGGGGCTACTTCTCCGCTTAGATATTATCGTGGCGATGCCAGTACTCGAGTGCCTTCATTATCCGGTACTGGGGTGCGTTTTAC
GCGGTGGAACTTGGGCCAAATGATATTTCTTCGTCTCCGTTGTAGATTTCTTTCCTGTGTCGTTATCACTCTTTACTGATGGCGCTGGAAACCAGGCCAC
ACTTCTCTACGATATCTACCAATACACTGTACCTACCAACTCACTGCGAGCACGTTCTAAATGCTTAAGGCGTCATCCTCAAAATCTCTTTGTTCGGGTT
TGTCTTGCTGCCTTCTTGCCATCTCTATGGAAGGATGCCGTTGGTCATGCGCTGGAAATTGTCGTATTGACGAGTGCTATAGTTGTTGTTGCTCTTGCGG
ATAAGTGATAGCACGTGCGCCACGGTTTCTTGCTTGGATAACGACAGCTTGAAGCGTGAGCGCAGGCGCAATAAAATATAATCAGCGTCGATGCCCAAGA
AGCACGGGTATGGCGACTGACGTGACATAACATCCACGAGGTCACAGATCTCGTCACAGTGCTGTTGGCACGCCAGGAAACCCCGCGTGCAGAGCGTAAC
ATACTCCTTGAAGCCTTCGGAGTCTTGGCCACCCATAGTCTCTACCATTTCGGCCGTCAGTTTGAACGGCGCCGTCTCGATGCTAAGCATTCCACCCGGA
GCGATACCAAGCAAGAAACCGTAGTCGATATGGATAATATGGCCTTCGTTGTCCAGCATGATGTTGCCATTATGCCGATCCTTGATTTGAAGGAAGTAGC
ACACAATCGAGTATCCTGCCATGGACTGGATGTATTTCCGTTGTGCTTCCTTGAATCGATGTGAATCCGGCGGTCCGTAGGACTTTTCAAAGTGATGAAG
CAGAGAGACATACCCTTCACGCTTCTTCAGACCATCCAGAGAAATAGCGTTGATGAGGGTCTCAATCAGCCCCGTGGACGAGCTCGTAGCGATGATGCGG
TACCTCTTCACCCACATAGGCAGATTTGCTCCCCTGAAAATCTCGACAAACTTCTGAATCAACTGCAGAGTAAACACCTCCTGTCGAAGATCGTCATTAC
TCTTGCCAATCATTGACACGATATCCCACCCAGGTAGGTGCCCGTAAGGTGATGCGGCACACAGCCTTGTTCGTTTGGAGCTCCACGATTCGCCAAAGGC
CGCCTCGAAGTCTCTGCGGCGGGCCTTTTCACGCTCCACGGCCTCTGCAGTCAAATCACCCGTAGCCAAGTCCATTTCCAGTGGTGCTGTCGGCGCACCA
TCGGTTGTCGTTCCACTATCCACGGTAGCGCCCACCGTATTTTCAATTAGTATCGGAGGCGCCGTTGAAGGTGTAGAACAAATATCGGGAACATCAATAG
GCGTCTCAGGAACTGGGGCCCGGCGAACTGCAGCGACTGGTGTTTGATATGGTTCTGGAGCGATAGGAGGAGGAATTATAGTTTCAGCTTGGATTTCCTC
CACATCATCAGCTTCTCCAGCAAAAGCTTCACTGGCTTGGTGACCAATCAGCTGACCAATCTCATCGTCCTCGACGTAGTTGACCTCAGAAGATTCCAGC
GCACCGTTTCCGTTCATATTCTGCCTTGAGGGAGACCGCGGTGATTCGGGAAGCGAGGTATCTTGCTGTTGGTCGTCGGTGAACGGGTTGCCACGAATTA
CCTCGAAGATCAGCAAAATAGGAACGCGAGCTTTCGTCGAGAAAGCGGTGCCTTCCTTGGTAGGTATCCGCACAATACGTTCGAATGGGTCTGTTGCCTT
TACCAACGGCACATACGCCATGGGAGGGAGATGCAGTTTCTCCAAATACGATGGGAGTTGTTGTTTTCGATCCTGAATGGACGGCACGAAGCGCAGAGCC
TCAGCAATGTCAGTGATTTGCTCCACAAAATCACATTCGTCAGCGAAATGTTTTGCCAACAAGTGCTTATCCGTTTGGCTCATTCGACGCATAGACTCAC
TGAAGATGCTGGTTGGCTGGTTATCGGTGTCCTCTTCCTCAAGAACCGACAATCGTTCATCTTGTTCATAGTCGTTATCTGTAGGATGCGAGATCAGCAT
AGAATCAAGGTCTTCCTTGGGTGTCAACAAATGCTGTTGGAAGCGCGAAAAATCACGGAATCGACTATCGACATCAGCATCCGACCCGCTGCGATCGGTG
CCATTCCTAGCCAATGGCGGGGACAATGGTGGGTATGGATTCATAGCTGCAGGAGAGCCATTGGCGAGAGCGCTGCTCTGCGCGAGACGACGGTGGGTCG
CAATCTCCTCTGTCAATTTAACGATAACTTGCAGCTGATCATCTGTGGGATTCGGCAGATTACGCTTGTGCCCCTGGGCTGTCTCCTGCTGCGGATCGCG
ACTGAGCACGGTTGCACGGTCTACACCGGCAACCTCGCGCTCAATCTCGACCATCAATCGCACCACACGTGGGTATTTATCCTGCATGTCCTTGGGTTTC
CTCGGATCAAAAGAGTCCTCCAGCGCGCCTTGTAGTTGCCAGCGAAGAAGAAGAGCTAGGTGGATAGATCGCGAGCACACCGACAGGATGAGCTCGTCCA
GCCAGAAAATCTTTTCAAAGTCAAAGTTCGGAATCGATAGGTACGCGTGCACGATCTGCGGCCAGTAGAATTCCACTTGGTTGATACGCGTGTACGAAAA
ATGCAACAGCTTCTCCACGATAGGCTTAAACAACAGAGGGTCACTGTCCAAATAGCGATGCAGCAGAATCACAGCACGATAGACGCTAAAGCTGCGCACA
CGGAACTCGCGGTGTAGACCTAAGATTTTCAGGTCTAGAGGTATCTCTGGATGGTCCATGGTGTGATCATAAAAGCGTCGATCCTTCAGCAAGATCTCTT
CACATTCTTCAGCAGTAATTACCTTTGCTTTGAGCAAGTCAATAGCAATCTTTGCAGACTCAGTCTGCAGCGGACGCTTCGGCATGATGAGCTCAATCGG
AGCCTCTGGATTCAACGGACGCGGATACAAGCAAATACCAGCCTTCAGTCGCTCCATCATCGCACGCAAATAGTTAATGTAATTCTGTGCCTCATAGCAA
CGGTCACACACTCGCTTGGCGTAGTAGTGCGACCTCTGCGGGAGCGGCACTTTGTGCGTCGTAAACTTGTCACAAAACAGTCCATCACAACTGTTACATT
TGTACAGCAACGCAGCAGCAGTCGGGGCCAATTGCCCCGCAGAAGCAGCCTCTGCTACCAACTGCGTGCAGTCCGGACACTTGCACGTCACATCTGTCTC
ACTCGATGGCACCGTCACGGTGCTCACGGGCGAGATCGACACATCCAGCGTCGCGTGCTGAAAAAAAGCTGCTGTAAGGCGAGGCACCGTGGTCTCCACT
GACGTCTGGATGGCACGGATCCATTTCTCTTTGTCCATGGCCGTGTCCGCGTAGGCGTAGAAGACCTTATTCTGCGCCGTGGCAAACAGGAAGCCGTGCT
GGTAGATGTGCATGTTGCCTTTGCCGTCCCACTCCTGCACCCCCAAAACGTCCGCTTCGCCCTTGAGCCGCAGCATGTGATACGCGTCCTCCTGCGTGCT
GCTCGCATCACAAACCCAAAGCAATTAGCACCAGGAGTCAGACTAGTACCAGAATACAAATCATATACTGTACCTATAGTATTGGAAGGAAGTGCCCACG
AGGAAGCAGTAGCGCCGCAGCATGGGCGGGGGTGACGACGGACTCGTGCGGAAGGTCAGGTAGCCCTCACAGCTGGCGCGCGGGGCCTTCATGGAGCTCC
ACGAGATCAGACGCGGTCTAATACGACGGCGGCGTCTCGTGGTGCTGCTGAGTGTTGATGTGCGCTCGCAACGGGGCGCGCAATGCCGATCTGCGCGTGG
ACTTGGGCGACGGCTGATTACTCACCTCCGACGCACCCAATACACACGATCAACGGATCACCGGACAGAGCAGACGGCGGGGGGCACGAAGAGTCTGAAG
CGGACGGCCACGCGACGCTAGGGACGCGTATGGGGAGAGGGAGCGCGGGCCGAGAGCGCGCGAGCCTTCTCTCTTCAAGTGGGCGTTGCGGTGTTGCGTG
GGAGGGGGGAAGAGCGACCCGCGTTATAGTGGCGTGTCACAATCATGCGGGAATGGTACCATGAGTATGGTACACTCGGTTTTGCTGGTTGCGAGCCCAC
CAGCAATTCGTGCATCAACGCATTCGCGACTGTAGTAGACCGATGGCTCGCGGGAAAAAGACGTTGGCGGCACCGCTGAAGGCGTCCACGCCCAGCGTCA
ATGGCGGCAGCAAAAGCAGCAAAAAGACGGCCGGCGTGGCGCAGAAGAAGCAGAGCAAGCAGGTGAAGCCTTCCCCAAAGAGCCCCAAGAAGACGGTGAA
GGTGGCGGTGAAGGCGGATGAAGCAAGCGAGGGAGAGGAAGAAGACGAAGAGGCCAGCGATACTGAGAACAGCGACGACGCTGATGACGAGGAGGATGAC
GAGTTCGAGGACCAGGGATCGTCGTCGGACGATGACAGCGGCGACGAGGAAGAGGACGACGCCGACCTCACGGAGCTGGAAAAGAAGACGCGGCGCTTCA
CTGTGGACCGCGAAAACGAAGTGCAGAAGATGCGTGAGGACGGGTCGCTCCAATTGGCATCGCAGTTGCACGTGGACGACCTGTCGTCTGATGACGAGGT
TGGCTGCCAATGCTTGATGCATGTGTTGCGACGTGTGAACTTATCCTTTGGTTGTGCTTTTGCAATGATAGGAAAATGTCAACACTATTGGTAACGTGCC
ACTTCGGTGGTACGAGGATTACGACCACATTGGTTACAATGTGGACGGCAAGAAGATCATGAAGTCGAACAATGGCGACGGCATTGACAACGCGATTGCC
GCGAAGGATGACCCGAACTACGAGTAAGTGACATCGAAGCCGTAGGATTCCTCTTACCTGCAGACGTCTGACTGTGTGTTTGTCCTTCTTGACAGCCGCA
CCGTGTACGACGCTTACAACGACCGTAAGATTGTCATTTCGGAACGTGACATGGAAATCATTCGTCGTATGCAGGCGGGTGCATTTGCACACCCGGAGTT
CGAGGCTTACCCGGACTATGTGGACATTTACTCGTCGAACAAGATGATCCACTCCATGGGCAACGAAGTTGAACCCAAGAGCCGTTTCTTGCCTTCAAAG
TGGGAGCGCATGAAGGTCATGAAGATCATGAAGGGCATCAAGGAAGGTCGCATCAAAATCGATGAGGAGCCAGAGAAGAAGCCCGATGTATACCAGATGT
GGTTCGATGATGACCAGGCGCAGACTCGGAAGGGTCCTGCTCACGTACAGGCTCCGAAAATGCCGCTGCCCGGACACATTGAGTCGTACAATCCTCCTGA
TGAGTATCTGTTTACTAAGGAGGAGCGTCGAGCTTGGGAGGAGGCCGAGCCGGAGGACCGCGAAACTAACTTCATGCCGAAGAAGTTCAAGTCGCTGCGT
GAAGTGTGCGGTTACAATGGCTTCGTGCGTGAGCGCTTTGAGCGTTGTCTGGACCTGTACTTGGCGCCGCGTGTGAACAAGCGTAAGCTTAACATCGACC
CCGAGTCGCTTGTGCCGGAACTGCCGAAGCCTCAGGACTTGCGTCCTTTCCCAAACACACTGGCGCTTGTTTTCAATGGCCACACTGGTCGTATCCGATC
GCTGGCTGTGGACCCGTACGGCCAGTACGTGGCCTCGGGCTCGGACGATTTCACTGTGCGCATCTGGGAGATCGAGACTGCGCGTTGCCTGCAGGTGTAC
AACGTTGGTGCCGTGGTGCACAAGCTGTCATGGAACCCGAACAAAGACCACCAGTTGCTGGCTGTCGCGGCTGCTAAGAAGGTCTTCATTATCGCTACCG
GAACGGGTAGCGCGGATCAGACGGAGCTTACCAATGCCCTCGTGGGCGACGCCGACGAAAGCATTCAAACGTCCTCCGAGAAGGATGACAAGACAGATAA
CGCCGATGGCGACGTCCAAGTCGTTGATGAGGATGAGGCCACCGTAGAGGCTGACGCGCTTAAGAAGAAGGTGCCTGTGACTTGGCGATTCTACAGTGGC
ACGAAGGACAAGCACAAGTCAAAGAAGGCTGCAGAGCGACCGTGGCTTGAGCGCCGCGTGGGTACTGGTATTCGTGTGGTGCTGCACCACACGAGCGACG
TGAAGGACGTGGCCTGGCACCACAAGGGTGACTACCTCTCGACGGTTGCCCCTGGCGCCGGCTCCGGAGCGGTGCTAATCCACCAGCTCTCAAAGCGCAA
GACTCAGAACCCGTTCCAGAAGAGCGTGGGCCAGGTGCAGTGCGTGCTGTTCCACCCGTCCAAGCCGTTCTTCTTCCACGCCACCCAGCGCCATGTGCGC
GTGTACAACCTTGTGAAGCAGTCGATCGTGAAGAAGCTATCCTCCGGCGTCAAGTGGATCTCGAGTATGGCCGTGCACCCGAACGGAGACCACCTGCTTG
TGGGTAGTTACGACCGGCGGTTGTGCTGGTTCGACCTGGACCTGTCCTCGAGGCCGTTCAAGACGCTCAAGTACCACGAGAAGGCTGTGCGCGACGTGTC
GTTCCACGGCAAGTACCCGCTCATGGCTTCTGCCTCGGATGACGGCACCATTCACATCTTCCACGCCATGGTCTATTCGTACGTATTGCTTGGCTCTTGC
ATTTTCACAAGTGGCTTCACTGAGGCGAGCCAGAAGCGATTAATTGAGGTGCCTAACTGCTAACTCATGTCGTGGCGTGATCTCTGCAGGGACCTGATGA
AGAACCCGCTGATCGTGCCGCTCAAGATCCTGCGTGGCCACGAGGTCTCCGGCGGCCTTGGCGTCATGGCGCTGGCCTTCCACCCCGTCCTGGTACGTTC
CTTCTGCCGCTCAAGCAACGTCACGCCATTACTACCGATCTAACTCTTGTTGCAATTTGTGTTGATTCGCTCAGCCGTGGGTGGTGACAGGCGGCGCGGA
CGGTTCCATCCGCCTCTTCCAGAACATTCACTAACTCGCCCGTTGCAGCGACCGATGAATCCGAGCAACCGTCCACAAGACGTCGGTAGCGGTGCGCTTC
TGCAGCTTTCGAAGGAGGAAATGCGCGCTGCCGTCTCGGCGTGGGCAGCTAGCAACTGTGACGATTTCAACTAATAGACAATGTGCCTTTGAAACCTCAA
TGCTCGATGCCATAGAGACGACGATCGTTTGTGCCTCCGTTTTGAGCTGCCGGTAAGCGGTAAGGCTCAGGCGAACAGCAAATTGCGCCAGGCTCATGAT
GACGGCACACCTCGCCTTTCCTAAGCTGAAAGCCAGTGCACTGACGCCGCTGCAATGCTACAGCAGCATGGACACTTTGGTAGCATGACATGTGAAGTCC
TTAATTTATTTATCATGTAAAGGAAGAGGAAGAGTACGCGACAGTCTCAGTCAAGCTAAGCTACTCGGTCCAAGCGGATGGAACAGTCCTCCCTCCATCT
GCACGCATCAGAATACACCACCACGGGGCTCTACTCGCCGGGAGAAAGAGACCACAATACTTGATCATCGTCGTCCGCCCGCTTGTCCCTTTTCTCGGCG
AGGCTGCACGCAACTTCCAGAGAGCCACGCGTCCGTCCTAGTTCTTCTTGCCCATGCCCGGGATTCGGAACCGTGAGCGCTTAGGAGCTGCTGCAGGCAT
CGGCGGCGGCATCTGGCCGTATCGCACGGGGTACTGGTACTGGCCGCCTAGGGTCGTGGCCGGGTATTGCTGCTGCTGTTGGGGCTGACCATACTGCTGC
TGTTGTCCATACTGCTGCTGCTGGGGCTGACCATACTGCTGCTGCTGGCCGTACTGCTGCTGAGGCTGGCCGTACTGCTGCTGGGGCTGGCCGTACTGCT
GCTGGGGCTGGCCGTACTGCTGTGGCTGGTTGTTGCCGTAGCCGTATGTCGGTTGTTGTTGTTGCTGCTGCTGTTGACCGTACGTCGAGTTCTGCGGCGG
GTACGTACCCGTGGCCATAACCGGCGGGTAGCCGGCGTTGTTCATGGGGTTGGGGCGGTTCTCCTCGTCCGAGTTGCGCTGGTTGGCGTTGGAACCCCCG
CGCTTGTTGTTCATGGCGTAGAGCGAGCCCTCTGTGGGCTCGCCGTCGCCGTCCAGCAGGCTGGCGCCGTCCACTTTGCCCTTGCGGTCCAGCACCGTGT
CGCCTGAGAGCACCGCGCGGTCCGACTTCTTCTTGCGCAGGAATCCCACCATGGTGAGAATAAGGAGGGCAGGTGGACGGTTGCGTGTGTAGATAGCAGA
GCGAGGGGGCCGCTGCTGCTGAGTACCGAGAGCTTCCTTGCGGGGACCGGGACGATTCAAGTATGGCAACGCGCGTGCGTTTGGCTTCGAGTGACCAGCC
GGAAACTGCGCCCCCCTGCCGCTCCTCTTCTATGCTGAAGAGATTTGTCGCAATTTTGTGGAAATGCGGCACTGGGCGTTTGTATGGAATTTCACGTCAG
CGCGAAAAGGCGCCAGCCCAGAGGCCCACTGCGGCTCACCTAGTCTCGAACTCCACAGCCAAATCCACGTGGACGCACACGAGCGAGAAAGCTTGCTGAC
AGATGGCCACCAGACTGGGAGTGACTATGCCGGCCTGTCGTACGGTTGTGTCGCTCTACAACGAGGGCTAACAAGCCGAGTCTGTGCGTAAACCGCAGCG
GCAGACTGCAACTTGTCGTGCAATGGGTTTACGACTCGCAGCAGGGCATGTACCTGTCCGTCGCTGGGAGAGCTCCGAATTACTGCTACGTGCACTGCAG
CTTTCCACGAAAGCAGACCATCTGACAACACACCGTTGCCAGCTCGCAAGCCGAAAACAGCGGTTTAAGACGAGGGTTTCAGCTGCGGACAGCGGAGACC
CACGACGACGACGAGATGGCGAAGCCAAGCCAAGATATTGCATCCGAGGGTTCGTTCTGTCGGCTGTCGCCGCGCTTAGCTCAACTTGCCTGGGCGTAGC
ACCGCGTCAACACGGTTGCGTCCGTTTCCACCGCTGCGCTAGTGCGAAATTCAAGTTTCAATTTTTAAGTTGCAGTGTCATCGCAGTGGTATCTTACGTA
TCCAACGCGACTTTTTGAGGCTGAGACATGTGCAACAAAATGGCGAGTAATTGCAGCGAGACCAAGCACCACAGCCTCGCTGGCAGCAAGTTGCTGCTCG
CTACGCTCGGCCTAGTCGTCGTCGCCTGCTATGACCAAAGAGCTTCACGTCCCGGGACGTCTGTGGTTCACGACGCTCAGCCCAGTCGATGATGCTTGAC
CGATCACATCCTTCAGACGCGGACTCGCTGTCTGTCTGTACGTCACCGCAATGACCGCCCGAGGACAACTTCAACCACACAGCCTCACAACGACGGCAGC
CAGCCCGTGCAGCCACTTTTCGATCGCCCGCATTGAGTCGAGGCTCGACATCCCAGAAGAGCTCTCTCGCCGAGTGCGTGGCCTGAATGAGTCTCTACAC
CAGCACGTAACCAGACCAGCCAGCACCAACGTTGGCTTCGTACTACCTCCACGTGTCCAACGTGCGACCGAGCGTTGCATCGAGCAGCTGTGCGGCCTGG
GCAACGGGCTGCACAATGGCCTGCATTGACGGTGTGCCTGGACTTGCACGGCAAGATGCAGTGAATCTGGCCCTGCGGCATTTCTATCAACAGAAGGAAC
AGCAAAGTCCGCGAGGGTTGGACGTAAGTCAACAACCAAGTTCTTCACTCATTACCGGTCCTGTAACGAGTTGATATCAACACACTTGGTAAGAGCATTA
GTGTATTAGCACGCTACACGACCATCTCAGTCAGGTTGGCGTGGTGACTGTTTGTGAGGGTGTCTCTGTGTAATGGTGGTTCCAGTGGCGACCGGGAATC
TGTACTGCTATGCTGCGGGTTAGTGTCTTCACCACGTCACGTGTTTGTCGAGGAAATCCCGTGTCATCTCCTCGTTCTGCGCTATGTTCTCCATGTAGGT
ATCATAGGACATGTGCCACGGATCCGGCACGTCTCGCGTGAAGACGGCGAGCACGCTATCTCGCTCTGTGATCTTCGGGAACTTCTCCGTGACCTTGAAG
GCCATCCCGCTCGCCACGCACACCACGTAGTCGGCGTTCATGCACATTTCCTCTGTCAGCAGCCGCGAGCGGTGAGCCGACAGGTCCAACTCGTACTTCT
TCATCACGTCCACCGCGAACTTGGACGCGGGCGAGCCCTCGCGGTCGAACACGTCCGTTAAACTGCACGGCGAAAACAACCATCAGCAATTTCGGCAGCC
TCCGCAAGTTCCTAACAGCGAGGTTCGCACGTACGCTGCCGACCGGATGACAATGCCCTTCTCTTCCTGCTGCTCGCGCGACATGTTGAGCTTGCGCCGG
AAGTACTCGACAGCGAAGAGCTCCGACACTGGCGAGCGACACGTGTTGCTTGTGCACACGAACACGATGTTCATGGTCTCTTGGCGTGTGCGGTGCGGAC
ACAATTCTGATGTGGAGAGCTTGCTGCGACCCGCCGCCCAATGGTTACAAAGACTCCACAGCCAGCAGTAAACGAACGGGGCTGGAGGTGACAATTTCGT
TCCCGCTCGCCTTGTTGGCGTCGCCGACTTCAAGCGCGATGGCCGTCGCATGCGTGCGGAGTGGATTTGCAGCAGATTTCCAGGCGACCGCCTGAAAGCT
TTCGACCGGCATGAGCGACAAGCAATATATCTACATGCACGAGCAAATGCACACGAATATGCACTGCTCGCTCATGCACAATTTGGTGGCGAATTTGCCA
CACGGGAACTATATTTGAAATGCCACGAATGTGCTTCCAACGTATCCAATGCAACCGCAGCTAGTTTACTGGAAGCGCTGAACGACCTTCGCGTACGGGA
ATGGTCCCAAAAACTCGCTGTGGTTTTGCTTCTTGGTAGACGCCTTGAGCAACGAATAGTCGAGTTCCGTGTGCAAGTCTTTGTTGGCAGCGTACGACTG
TGGATCCCACTGGATGTCGAAGCTGTTGACGAAGAAGCCCTGGAATTGTGCGATCCATTGACGCAACGCCATGTACGGGATGAAGTAGAAGCCGCACCGG
TCAGTGTCGTTCTCCTTCACCTCCTCATCAACGGGTGCCAGAGTAAGCGCGATGTAGACCTCTAGCATTGGAGGCAGGCACATCTCGCGTGCCACATGCT
GCTCTGCCGAGTACTCCCACAGGCACATGACAGTCATGCGGTCGCCCCAGTCCGTCGTGTTGCGAACGAAGTAGGTGAAGTCGCTATCCGTACGACATAG
CTCTGAGTCCTTGCACTTCAGATGTAGTGGCTGAATATTGACGTCTGCGAACACTTTTGTCTCGTCCGAGAGGCAGTCTTCGATACCTTCATTATACTCC
AGGGTGTTGTTCGCTTGCTGCTTGAACGAAATGCCTTCATTGCCGCACTGGTACCAGTTGAACGGGCTAGATAAATGTACCAAACAGAAACAGTTAGTTA
GTCATTTTACAGAGTAACCATGCTTCGCAACGTACTTGTAGCTGTTGGGGCAAACCGAACGCTCTTCCCAATCCGAAACCTCCTGCATCCAGTATGCGAG
AGAGTGACTGCCTTGATAGGGCCCATCCGCCCAGGAGTTCTTCACGATAAGTCCGCCAGTGAAGCCTTCGCGAGTAAGGAAGGCGTCATTGTAGCCTACA
AGAAGCTGCCAACACAATTGCAAAAAAACCGGGTAAATGACGTAGTCGTCACACAAATCTGACAAATAACTTACCATGGCGTGACCACCCTCGATTGACA
TGCCACGGTGGCTAAAGAATTCGCCTTCCATGTTGCGGTTTCGACCTCCCTTCAAAGGAATGCAGCACGTCGTAGTAGCCATATCTCCTGGACACAGCGT
ACACGTTTCCGGCTGGCAGTGGCGATCATTCGAGAACGCGCCAATGCACGGGTAATAGTGAGTGACCATGGCGATCGGAGTGGAGAGAGGCATTGCTTGA
TTTTTGCGGACAAGGTGCTCCCTCACGGACATGTCTTCATACTTGGTCGTCATGCTCTACAATATCGAAATCGAAACAAAACACAGTGTTAGCCAACCTA
ATTTCCGATGTGATTCTTGACCGAGTCTCTTCGCTTACAGAAAGCTCGAACTTGAGCGGATTCCCAGCCGTTTGGGCGGCCTGGAGACCTGGACAAAGCA
TGTCGTTGCCGTCTTCGGCGTAGTATTCGCAGACAGATTGCGGGAATACAGACTCTTTGAGACCATTTTGTAGGTAATAAAGTTCCGGTACCTCTCCCCC
CTCTGTCGAGTTCATCCACATCTGTATATAGCAACGTCAGCATTTGACAATAGTTCCAAACAATAGAATATGGCTGACCTCGTCACCCGCCACTCGGCAA
TCCTTTTGCTGCTGTGAGTCTGCATCACCGGTGCAAAGCTGGAGGATCTCCACGCCGTACGCCTGCAAATAACCACATCGATAATAAACACCGATGTTCT
GCAACAACTTCACTCAAGGATATTAGTCCAACGTACCTGCTCAGAAAATGCAACATACTCATTAGGTTTGAGCCAGCCTTTGCGGACACCGTGTGCGCGA
TACGACTGCTCTAGGAACCCGATCGTCGCAAAGTCCCAGCACGTGCCACGATAAGCCTGATCCTGGCGCGGAGTCACGAAGTCCACCGCGAACTTGGATG
GCAGCAACGCCATCGGGATCAAACCATTTTTGGAGACGAAGCTCATGGCCACCGGGTCGAAGTCCTCATGAGCAGCATTCGGCGCATCTTGGCGGGCTTC
GCTGGCAGTCTCCCTGCAACAGCATTAGGTCAGTAATGATAACAGCCAAACGTTAACAACTCTTCAGATCTTTGCAAGGCACATACCGGTACATGCTGCT
GCCAGCCTGAGTTTCCAGACGCGAAATCGTGTTGTTCATTGAGATACATAGGAACAGGAGCACGAAAAGCGCGACGCCGTTCACCGCATAGAAGACCGTC
CGCAAAGGAAGGCGGGGCAGTGCACCGCGCTTATCAGCAACAGTGAGCTGTTGCGAGTGGACGGGCAATTCATCTCTGTCGTTGTTAGCTGGGTACAAGC
ACCATAACGCATTCGCAGACATCGTTAGCGTGCGATAAACAAACTCGCCTCTGGGCTCTAATCGTACCTCTCCCGGAGCCGTAGCGTAGCAGAGGACTGC
GGTCTCTAGCGGAGACCGACCTCACCATTCGTCGTGCGGTGTAGGAGACGCGTTGAAGAATGACGTCTAGCAGCCGATCGGATTTCTGATCGGCAAGTAC
ATCCGAAATATGCTTACCGTGTGCAAACGGACCAGCGAAGGACGCCATTTCTATCCAATCATATTCCATATTTTTCAAATTAGAAACGTTTGATTGGTTG
TTTATGAGGTGTCCGTAAATGGCGAACGTCCGTTTATACACAAGGTTCGCGGTATTTGTATCAAAAATGACTTCACTTCACTAGGATGACAGGAAGGAGA
GCTGTCTGCAAAACGAGACCTGTAGCTCCAAGTTGACCGTCGTGACTGTGAGAATGCTATACCTATAGATATTAACATAGTTTTTCCTTCAAAACTGTCA
TCGCAGACTACTGTGCATCTACTCTTTGCAGCCATCGCCACCGGCGATCACGAGACACGCGGTAGAATCGAAAATGCTCATGAGGTTGGTCATGACGGAC
CAAATGAGCGAGAGCGACAGATACGCCACCGTGACAAACCCCATGAAGTAGCTAGAGCCTCCCAGACGCTTCATCATTTGGGTTTGTTCCTTCTGTCGGG
GAAGCATCACCAGGAACGCGAGCGAGAACAAGTTGGCCGCCCACATGATAAGTACCGTAATGGTAACGTCGTGCCTTACTCCTTGGGAGTCGTTCTGGAT
CCGCTCCGTTGTCAGGTCGAATTGACCATTGACATTGCGGGTGATCGCAGTTGCAAAAGGCGTCGAGAGGTTGTAGACCGTCGTGAGCAGACCATACATG
GCACCTTCGTGCCCTTCCGTGGACAGCTCGACGATGATGAAGGAGCCCACGATGAAGATGATACCTTGTGGAATTTGCTCAAGAATGGGAATTCCCATCC
AGATCCACGGCGAACGGACGACATCCCAGATTGTCAGGAGCTTGCCCACAGCATCCAGGCTCACGTTGCAAATCATAGTCACGACCGCCGTACGCCGCCA
GTCCCAGTCGCGACCGTAGTTGCCGGCAAACCAGACTGCGATGGCAAACACGCCCGTGTTGATGAAGCCGGCAATTTTATCTTCGAGCGGCGAAACGTTA
GCCCAGGTGGTCTGGATCGGATAACCCGATACGTACGTGAATGACGAGAAAATACCCGAGAAGAACTGGTAGGCAATGTACTGGTACACGGCCCGTGTCT
GTACAACGTCCCAGAGTTCGCACATGTAGTGCTTGAAGCTCTTGCTATCACCCGGGCGCTTCTCTTCGTAAATAAACATCCACGTGATCGGCACAATCGG
CACAAGAGCGACTGCCACGATCAACATCATGATTGGGAACGTGAGCGAGAAGTTAAAATCGCCACCGTAGTCCTCGCCGTTGAAGCAAAATGCTACCAGA
ATGAGAGCGAGGTTGTTGAACACAAAGCGTGTGGTGTAGATCACAGTTTGGGTTCTTCCTCGAATTTCGAGCGGCTCGCGCTGCGCCAACTCCACCACAA
TGCCGTCGGCGCACACATCGGCCATCAGATACCCGAACGCGCAGCCCATCATTGGTATAACGTAGACGCTGCCATCGTCGGCTGCGCCGTAGTTGAGCGT
GGCAATGATCTCGGGCGTGTAGTCCTCGGGCTTTATGTCTCGGTACGCTGGGTCGGTGAAGTACGGCTCGCCCTGGGGTGTGAGCACCATGACCAAAAGC
ATGGCTAGAGTGATGATCCAGCCGATGACCATGTACGGTCTACGGCGATAGCCATGGATCGGGAAGCAGTCAGACACGATGCCGTAGAAGACCTTGAAAC
TCCAGGGCAGCTGCACAAGCACAGAGGCTGTAGTGGTTTGGGAACCGGGGAGGTTGAGGTAGTTCTGCAGGAAGGGGTAGATGACGTTGGGCAGCACTCC
GTCAATTAATCCAACGGCCGCGTACTGCGCGACAAGGCCGATATACTGCCTCGAAAAAAGTTTTGGTGCGCCACCGCTCCGGAGCGCGCCGCCTTCGATG
TAGTCGTCGTACACGTAGCGCATTTTCCCGTAATGATGCGCGGGTTCCAGCGGCGACATGCTGCATTGCGAGTCTCCCAGCATCGCGGCCGCGTCAGGGT
TGTACAGCTCAATCTGTTCCGGTAGTGGCATTTCGGTCTCCGTAGGCCTGAAATCAGACAGGCTCATGTGCTGAAGGCTGCGAATCGAAAACTACTGAGC
GAGGGGATCTGCTTGCAGGGCAGATAGCATGGATAATCGCAAGTGGTGGACTCACCTCCAGGCAGATGCAGAGGTCGGGCCGACTTTTCCGCAGGATGTG
CAGTGTTAGTGGTTCACCTCGCCATATTGGCCGCCATACTGGTTTGGCATCATCGAAACTTTCTCATGAACAGAGGACAAAACAGAGGGCACCGAACACA
CGCAAGAAATGCAAATTCGGTAGGCGACACTATCGATTGCCGCTGTTGTAACGGCGTTATTGCATGGACAGTAAGGCTTATTTAGCTACACCTACGCTGC
GAAAGAAGGTTCGAGCGGACGAGCAGTGAGATTCCGAGTCGGAGTGCACATGGTAATTCGGCAAGGGCGTACGTATCCTAGACTCATGCCTGGTTGTAAT
TTGCTGGTTTGCTGGCTTGATGTAGTACGGTACCGGTGCTGGTATTCATACAGCAAACCACCAAACGACAACACCGGTGCAGCAAACCATTTGGTCAATC
TGTCAACTGAGCTGCTCTCTGCAACTGGAGAGAGCACCTTCAGCTGGCAGGGGGTGCTGACCGTGACCGACCATAGGGTCCTCGCTAAGCACTACTGAAG
TACTTGCACATGCATCATACATGATCTACAGTACACGTAGGGGGTTGCACACATCTTGAGCTACCATACCTGGCCTACGGGCTGGAGAAGTCCTGAGGAC
GACCACTCCAACGGGTGGTCCCATTCCGCCCCACACGGTACTTCAGCCATGGACCGGTACAAGCTGGCAAGAAGTCATCGACGACTCGCGTACGAGTTGT
TGAGGAAGGCCGCGCACAGTACTCGGTGCGAAGAAAAAAGTTTACCGTTCATGCGGTTGTAGACCACCCAGCAGACGCAGGAGCACATGGCACGCATGGT
AAAACGTGAAGCAGGCTTTTCGATGCCATGACTTGTTGTCGACTGTATTCAACAGAGACCTGGCATTGAGAATGGCATCGGACGACGCGAACTGGCTTGG
CCGGCTCGAGGCAAACGCCAGAGCTTCGTTTCTTGAGCGGTCGGGCTACGGGATACCTTCACGATTTGAAAAGCCCGCCAATGTTGCACTGAACTGCTGG
ATGTACCAAACAGAGAGCCCGTCCGAGTCAAAGTCTCTGCTCGAGACTGTGAGAGAGGAACTCTGCCAAGGCAGCTGGCAGCCGTCGTCAGTCTCGAGGC
TTCCTGCTCGATTTGTAGTTTCCCTGCGCGTTCAAGGTGGTACCCACCAAAGAAGGACGAAAACTGGTGGAGGTGTCGTGCCGCGAAGCGAAAACCAGGG
CTTGCTCGTTTCCTGTGAGCTTAGATATTGGACGAGAGGCTATCCAGGCCCCGCGTTGGACTGCGAGGCGTGTGTACACTGTAAAAATCCGATCTTACCG
CATTAGTCAAATTGCGTGACGAGAGGCACTCTACGACTGGTCTTGGTGGGTCTTGCGGGTCAACGGACAGGTACCACCGTCATGAAGGCATCGCGGACTG
ACACGGTGACATCGCAGCAGGCACCAATCGAGCTGTACAACGAGGACTCGTGCTCGTGGATGATCACCGATTCTCCGGACGATGGTTCGCCGTTCCCGAT
GACGTTCGAGGGCCAAAAGATCCGCTACATCTACGACGACTACATCGAAGGCGGCGCGCTCCGGAGCGGAGACGCTCCGAATCTGTTCTCGAAGAAGTAC
ATCGGCCTTGTCGCACAGTACGCCGGCGTCGGATTTATTGACGGAGTGCTGCCCAACGTCATCTACCCCTTCCTGCAGAACTACCTCAACCTCCCCGGCT
CCCAAACTACCACAGCGTTCGTCCTCGTACAGATGCCCTGGAGTTTCAAGGTCTTCTACGGCATCGTGTCTGACTGCTTCCCGATTCGTGGTTACCGTCG
TCGACCCTACATTCTCGGCGGTTGGGTCTTCGCGTTGACCATGCTTGTGATACTGGCGCTCACACCTCAGGGTGAGCCGTACTTCACAGACCCAGCGTAC
CGAGACGTAAAGCCCGAGGACTACACGCCCGAGATCATCGCCACGATCAACTACGACGCAACCAACGACGGCAGTGTCTACGTTATCCCAATGATGGGCT
GCGCGTTCGGGTACTTGCTATCGGACGTGTGCGCCGATGGCATTGTGGTGGAGTTGGCACAGCGAGAACCTCTTCAAGTGCGAGGCAAGACGCAGACGGT
GATCTACACGACGCGGACAGTGTTCAACATGTTGGCATATATCCTTTTGGGCTTTTGCTTCAATGGTGCGGAATACGGCGGAGACTTTGACTTCTCACTG
TCGTTCCCGATGCTGATGTTGATCGTGCTGATTGTGCTTTCGCCGATTGTGCCAGTCACCTGGTTCTTCCTTCATGAGGAGAAGAACGCTTTCGGGGCTA
TGAACTTCAGTCACTACATGCACACCCTTTGGGATGTCATCAAGACACGAGCCGTGTACCAGTACATCGCTTACCAGTTCTTCTCGGGCATTTTTGCTTC
GTTTACTTACCTTTCCAAGAACCCGATCCAGAGGAACTGGGCGAACGTCTCGCCGATCGCCGAAAAAGTTGGAGGGCTGTTGTCAACGAGCGTGTACGCC
ACGTCGATTTGGTTCGCTGGCAACTACGGACGCAACTGGGACTGGCGACGAACGGCAGCGGTGACCATGATCACGTACGTGTCGCTGGATGCCTTTTGCA
AGCTGCTGACGATCTGGAATGTCATCCGCTCGCCGTTTTTCTGGCTTGGTATCCCCATTCTGGAGCAGATTCCGCTGGGTGTGATTTTTATTGTGAGCTC
CTTCATCATCGTGGAGCTTGCTACTGAGGGACACGAAGGCGCCATGTACGGCCTCCTCACGACGGTCTATAACCTCGCCATCCCGTTCGCCACCGCTATT
ACGCGCAACGTGGATAGTCTGTTTGACATTACCACGGAGCGAATCCAGAACGACAGCAACGAAATCCGAACTGACATGGCCATGACGGTGGTCATCATGT
GGGCAGCCAACTTGTGTTCGCTCGGTTTTCTGGTGATGCTGCCCCGCCAAAAGGAGCAGACACGGGCCATGAAGCAACTGGGCGGCTCGAGTTACTTCAT
GGGCGTCGTCACGGTGTCGTATTTGATGTTCGCGTTGCTGTGGACGTGTTCGACGAGTCTGCTGAGCATCTTCGATTCCACTGCGTGTCTTGTCATCGCT
GGTGGCAACGGTTGCAACAAGCCAAAGAGTCCGTAAAGAAGTCAAATAAGTCTATCTAAAATGAAAACTGCAGCGCTAACCGCTGCCAATTGAGTCTCTT
CACCCTCTCCACTCGAACATCTCTCATCTAGCACAAAAGCACAGCATACTGTAGCAGTAGCGCTCATTCTCCAAGAAAGTCTACACCATCTCCAACACAG
CCAACTCGACAAATGCCACGTCCTCTTCACTGAAAAAGCGACCAGTCCTTGACCGCGAAGGACTGCAGCGCCTGCTTAAATATGGCGGCGGCCACCTCCG
AGTTGTCCTCGAACTGAAAGGCGTCGCGGCTGCTGCTGGCCGGGTTGATGCGCATGGGTGCCGACATCGACAGCACCACGTCCGTGGTCACGCCAGGCAG
CCGCACGTTGCCCAGGTACACGCGCACCACGTTCTTGGCGTGGTCGCCCTCCTTGAACTTGGCCACGCGCTGGTCGCCCACGATGAGCTGCGTGGTATGC
GGCGCATCGACGGCGGGCGCGTTCCGAGCGTCGGCCGCCGCCTCCAGCAGTACCGTCACCTCGTCGGGGCCGCAGCCGTTGGACTGCGCCAGCTCGTTGA
AGAAATAGCGCGCGCTGCGTGCGTCCGAGACGCTCTCCTCGTACTGCAGTAGCTCCACAATGACGCACTGGTCCGTGGCCGCGTTGGCGAAGACCTCCTG
GTTGTCTGGAACCTGCCGGAACGAGCTCACGTCCGCGAAGCCCTCGGGGATCTCGCAGATCAGCGCGCCGCCGAACAACGGACGCAGCATCTTGACTTGG
GTTGACACTTGACTGAGGGGTTGATGTGGAAGTGAGCTCTTGGGTTGACACTTGCCTGAGGAAAGTGACTATTGGTGTACCGTACACATATTTGGTATAC
ACCAGTGGCCTGCGGCATCCAGCTATACTGTGTATAGGTGTGTCCGATTAAGTATCCACGATTCGGATGGGTCGCGGCCATTAGATCGGAAATCAACCAG
CAGCAGCAGCATGAAGATCGAGGAAGTGCAATCCACGGCCAAGGCGCAGCGCATCGCGTCGCACACGCACGTCAAAGGTCTTGGTCTCGAGTCGGACGGC
TCGGCGCTGCCCATTGGCTCGGGCCTCGTGGGTCAGGAGAAGGCGCGCGAGGCCGCGGGACTCGTTGTGGAGCTCATCAAGTCCAAGAAAATGGCGGGGC
GCGCTTTGCTTTTCGCGGGTGCGCCTGGCACGGGTAAGACGGCCATGGCTCTGGGTATCTCCCAAGAGTTGGGGCCTAAGGTGCCGTTCTGCCCTATGGT
GGGCTCGGAGGTGTACTCGTCCGAGGTCAAGAAAACGGAGATCCTGATGGAGAACTTCCGGCGAGCCATCGGCCTCCGCATTAAGGAGAGCAAGGAAGTG
TACGAGGGAGAAGTGACGGAGATGACTCCAGAGGAGACGGAGAATCCCCTCGGCGGCTACGGGAAGACCATCTCCCACGTCATTGTGGGCTTGAAGACCA
CGAAAGGCTCCAAGCAGCTGAGACTCGATCCCAGCATCTACGAGTCGCTGCAGAAGGAGAAGGTCTCGGTGGGTGACGTCATCTACATTGAGGCGAACAA
CGGCAGCGTCAAGCGCGTGGGGCGCTCGGACGCCTATGCGACTGAGTACGACCTTGAGGCAGAGGAGTACGTGCCCATTCCCAAGGGCGACGTGCACAAG
AAGAAGGAGCTGGTACAGGACGTGACGCTCCACGATCTGGATATCGCCAACGCCCGTCCGCAAGGAGGACAGGATATTATGTCCATGATGGGCCAGATGA
TGAAGCCCAAGAAGACGGAGATCACGGAGAAGCTGCGCACGGAGATCAACAAGGTCGTGAACAGATACATTGACCAAGGTGTGGCAGAGCTTGTTCCCGG
TGTGCTATTCGTGGATGAGGTGCGTGATGCAGGTGGTCTTGTTTTGGAAGAGTGATGAACTAACTTTACATTTTTGTGCTGCTGTAGGTCCACATGTTGG
ATATTGAGTGCTTCACTTACCTGAACCGCGCGCTGGAGTCGACGCTGGCTCCGATCGTGATCTTCGCCACCAACCGCGGTGTCTGCCAGATCCGCGGCAC
CGACGTTTCGTCTCCGCACGGCGTGCCGCTCGACCTGCTCGATCGCATGCTCATCATCCGCACGATGCCCTACTCCGTGGAGGAAATGGTTCAAATTCTC
AAGATCCGCGCTGAGGCAGAAAGCATCAAGCTCTTGGACGACGCCACGGTGCGTCTGGGCGAGATCGGTTCACAGACGTCGTTGCGATACAGTGCTCAGC
TGCTGACCCCGTCCCGGATCCTCGCAGAGACTCAAGGCCGCTCCGACGTGTCGGTGGACGACATCGAGGAGACCAACGACCTGTTTAGCGACGCCAAGCG
CTCGGCGCATGCACTCGCGCAGACGGAAGGATACCTTATGTAACGACAGACAAAGATACCTGCATCAAAGCGTCTGTCCGCCAAATACAATTGAAGGGTC
ACTCGCTCATTGACCTCTTGACTCGTGCTCTCCTCCTGTTTCGCTAGATGCAATGGAATCCATGAACAGTGAAGTTGTGCGGGAGTCTGCAATCTTCGCA
GCACTGTCTCCACGAGGGTACTCACGACGTGAACGCCCGCCGGGGAACACGGACCTTCGAGGCGCTTCGCCAGCAGATGGTGGGGCTGTACCGAGTGGGT
CGCTCCCACCGGTGACTCCACGTGATGTAAACGCCATTCTCCGAGCCCCACCGCAACAAAGCATGAAGATGTCGCCAAAGACACCTCAATCGCTGATGCT
GTCGGTTCCCATGACAACAAGCGAGTGCTGGCTCGTGTGGAAATTCTTGTGCGATTGGGTAAAAACGCAGGTAAACATTTACGAGTGCAGCAACTCGAAG
ATATTATGATCGGACTACATGTATAATAATTGTTTGTGTGGCGATATGTCATAGCTCGCGATGGAAGTTCCTGCTTCGATCCCTGGTTTCGGGACGTTTT
ACCTACGGGTCCAGTCTTTAGGCATTCGTATCACGCTTTTTGGTAAGTGAAAATTCGAGCATGAGACTAGTACCCAGGTTTTGTGCAGTTGTAACTTTTT
TCCGGCTTCGTAGAACCTGACAAGCAATTCCTCAACAAGTTTGGGCTTCTAATGGATTCGGAGATTCCTGACCCAGCACTTGTTGCCGTGCTGCCCCCAA
CGATGTCTAATTCCGACACATTGGCATCTACCGGTAGCCGTGGCCGAGCAGCTAGTGTTATCGGGCTCGGCAATGTCTTTGCATTTAGTTTCGTGGAAAT
GGCTGCATGCTGTGGGGACGCAGTCGATGCGAAAAGAGCTCAGGAATGGCTCACCGTGGTCATCCACAAACTGGGAAATGCTTTGAGTCAATGTGGCCGA
GTATGTGCAAGCCCACATATTTGCTGGTTGCTTCTATCGCTAACATTTACCGCTACTTGCAATAGGTAGAACTAAATATCGGTGTCGGGGTAATCGTGTG
TTCTGATCGTATCATTCGACGGCATCTACGCTCACACGATTCGGTATACGCACTATGCTATCAAGGCTAGATACATGATGGGAAAAGTTTGGCTAATGAG
GTTTGTTTATGCCTACCGCGTAGCGTGCTTCTCCACGACTGGAGTATGAAATTCGAACAGGAGAAAGTGTTGTCAAACGAAACTTGCGGGCTCAAGCCGC
TCTTCAAACCGTCCATACACCAACTAAGAACAGGCATGTCAAGGTTTACGATCGGTACTTTGTTGCAGCCAAACTAATTATTGCATGTGGTCTCTGTGTG
CACGCTTGCAGGTTCTCTTTTTTATCGGGGTCCACCTTTTCTTCATCGATCCAGCTAAACCCTGTGGTAGACCGATCCAAAGACGTTCCAGACTTCTCGT
TTGGGCCGCCAAACCCGCGACCACCGACATTTACTTCTGTGGGAGTTACTTCCGACAGTAGGTCGACTCCACTTTCGACTCAGCTAAAAAAGCGATATCA
GCGATCACCCAGCCCGCTAATCAATCGTATCAGTACTCATGTGACCGCACCGCAACCACCAGCTTATGAAGGGCAAGCAGCAAATAGTACACCGCCAATG
CAGAAGCAAACAGAAGAGATTTGGATGCCGCCGCAGCTATTTGATGGACTTAGTCGGACACTCTGTGTGGAACCTGATCAGAATGTGTCGTTCTTACTTC
CCTCGAATCGTATTGGGTCGAACTTCACGGAGTCTGCAGTGTTTCTGATGACAGAGAAATCCGCGTCTCAATTCGGTCAGCAAACTCAGCACGTCGGGGG
GTTGGTATTCATCGACAATCCGAGCTTCACTAATCTTCAGCTGCGACGCAAAAAGAAAGAGTCGACTGACAAGTCAATATCTGAACAACGATACTTCGAG
TATTTGTCCGATGACAAACTAATTGATCCCCGCTTCCTTGCGCCGCTTTCTTCTGAGCTCGAGACAAGAGTTGTGACCGCCGCTGTGAAGTATATTGTGG
GACCATCGAGTAATCATATCGAAAAGGTGATGGAAACAGCGCATGGTGAATTTACAGACAATTTCTACTCAAGCGCCAAGAAAGCGATTCTAAACTACCT
CTTGATGCGGGCAACATCCTGTGAGCGGCTTGGAATTCCACACGGAGTACCAATTCACGCCGTCCTCCCAACAAAGTGGAAATGGGGCAGTAGCGATGGA
CCCAATGGCTGTCTTTCAGACTTAAAGGCTTTGGTTTTAAAACATGGGGGCCGACTCACAAACTCCAAGCGCCAAAGGAACACCTATGCGATCCAGCAAA
CATTAAACACGGAGCGTTCTCGTTACTCGGAGGCAATTCATAATAAGGCCGTGCGTCGTAAGCGTGTACAGTCAAAATTGATGTCGCTATTGGTTTTGTC
GAACCCCCAGGTTCGGGCTCTACGTTTCATGTGGTATGACTTGCACACATCAGCCACATTGGTTGATCTCCCAAGCATTGAAGGGCTCAGCGATGTCATC
GAACCCATGGATATCATTAAGTTTGAACGAGCTCAGCTCGCTTTTTCTGCGAAAATGAAAACCTTTGTCATGGAAAATTGGTACGTGAAAACTAAAATGA
TGTTCGAAAGTGCCGTCCGAGCCGAAACCTTTTCGATACACACATCAGAGGCAGCAGTGAACTTTCGCCTGTGCCACCTTTTCGACACCGTAGCGGCAGT
AATGTCTCTCCAGCTCCGCTCGCTTATTATGAAGTCAATCCAAGCTTACGTCAAGTTTTTCGAGCTGTTTGGGACGATAAATGAAGATGAACAGGAAAGC
GGCAGTCTACGAGCCCAGGGTCGGTCAGCGCTCTCTGGTTTGCAAACAACGCTGGTCTTGAATGATGGGCAAATACAAGTAAGTACCGCTTTCATTTAGC
AATTATCTTTGCCACGCTAGCTGATGCGTATGATTTCTACTTACAGTTTCGAGACCCTCTCGTCGACATTCCAAGTCGCCTGTTGAACGTTCTTCACAAC
ATACCCAAAATGTTTTACAACCTCGGACGCATCGAAACACAATTTGAGGAACCACTTGTGCTGTCCAACACTTCTTCACCATTTCTGTGGAACGTAGCTT
CACAGGAGGACGACATCGTCGTTGCCACGATTCGAATTCGATCGATCATTGAGCACAACCTAACGTTTTTGCGAAAGCTGCAAAGCGAATACGACGTGTT
CGCCCTGACACACCGTTACGTGAATTCTGTTGACTGTTTTCACCTGGAGGAAAACGGAGAACTAGAAACCTACCGGGCTGAGATGGAACGCGTGCAGGCA
ACCACTATGCAGCTCGCGATCGACAATAGACATTCACAAAATCTTGGTCTTTTTTCAGTCGATTGCCGCCTCGTGAACACCAAGTTACACACCGAACTTG
CCCAGTGGACTATTCGACTGTTTCAAGCGTTTGAGCAGCGGACAGGTAGAATGAATGCTGAGCTTCGGCAGCAGTACAAGGAAATTGCAGCTCGATTGGC
AAAGAAACCATTGGATTTGTACGAACTCGTCGATGCCGAGACATTTGTGCAGTCGCTAAAAGCAGCTAAGCTACAAGAACTTCAAGACCGGGGTAACTCT
ATCAAGCAGCGCCTTCGGTTCTTGCTATTTGAGCGAGAAAATATGCACATTGGTAATCTTGCAATTGACTGGCCTCCAGATGCACCGCCAAACGATGAAA
GTGACGCTTCATCCGTACAGGTGGCAGGTTTCCGTCTCTCGGTTGATCTCCTCTCTTCGACAGCGAAGACTGTCAAATGGCGTAGTCATATTGAGAAGTT
GCTGAAAGAAGCCGAATCGCTGCTTGTAAACGAACGTGCACGAATTGAGGCCATGTTTATTGCGAAAAGGTCTCGATTTCAGGCTGAAATTGAGGAGTTT
GAGAGCGAGGTTAGAGGGTTTGCAAAGAAAGGAGATCTACGACATGCCGCTACGTATGTTGTTCAGCTTGCAAAAATGAAGGACAACATGTTTATTTTCC
GGCAGGCGATGGAGACTATCGTAAAGGAAGAGCGAAAGCTACAGTGGAAGCCAACGGATTTCGGCAAACTCGATGATATAGCAGAGGAGATGGCACCATA
TGAGCAGCTGTGGAAGACCGTAAGAGAATTTCGCGAGATGAACTCGCGGTGGTTACGTGGGAATGTATTCGAGCTACCAGGAAAGGAAGGAGTCCAAACT
CTGCAGCAAATGCTCACTGTCGTTGCCAACGTGTCAAGCGTGCTCCTTTTGAACTCAGCCGCGGCGGCAATCACTGCAGAAACAGTTCGAAAGCAAATGA
CAGACTTTCGTGAGAACGTTCGGCTAATAATTGCCATTCAAAATCCAGCGATCAAAGAGCGGCACATGAAAGCGGTGTCTGGGCTCATCGGACTGGACTT
TAGCTCTGAAGAAACTATCACGTTGTTAAAATTACTTGAGAATGGAGCTTTTGAAATGGTGAATGAGATCGTCGATATCAGCTGCAATGCAACACAGGAA
CAACAGATTGAACGAGCACTGAACGAAATGGAAGAGGAATGGGATGCAACGAGCTTTGAGTTGGTGCCATCTCGGCACCTATTTTCATCCAGTGCTGCCC
TTGCTCCATTCATGATCTCGGGTGACTCCGAGCGAGAATCATTTGACGTTGTGCTTAGAAAATCGTGCGCCGAGCGGATAGTAGCACTTAAGGAAGATCA
TCTTCTTCGGCTTCAAACACTATCGTGTATGTCACATGCAGACCCGTTCATCGACGATATAGCTTTGTTGCAAGCGTTTTCATCCGATATGGGTCAAATT
GTTGCGATGCTGGCTGTTATCGAGCAGCTGTGGCGCAAGGTAACTCCACTTTTTGCAGCTGGTATTGTCGAGAATGACTCGAACCCGTCTCAACTATTTG
GTAATGCAGCCCAACTGTACCAATCAACTCACGCTACTATCTTACAGAACCCCACATGCACAAGGTTTTTCCAGCGAACAAGCAAAACTAGAGACTTGGA
AAAAGTACCTATATCCTCTACAAAGACGTTAATTTCCGACTTAGAACAATGTCGTATGCTTTTGGAAACTGTACGAGGAGATGTCCGGGTAGGATTCGAG
ACGAAGCGATCGAGTTTTGCTCGATTTTACTTCCTTTCGGACGCCGAGCTGGTAGCAGCATTTGCACTAGCAATGGTGCCAGGTGATACAGCCCTTTGGA
AAGCGTTGTCAAGATGCTTTCCAGGTATTCACAGTGTTCTGACAAATGCAGCTAACGATATCACTGGATTACTTAGCTCAGCAGGTGAACCGTTCCCGCT
TGGTTCCCCGATCGTCACAGCTGATACTCCAATGCCTACATGGTTAGCAAATCTTGAAACTTCCATGACCACAATCCTGCATGCGTCCATCCGTGCTGCT
TGCAGTGATCTTCCACGCAAAGAGTTTCGCAAGTGGTGTCTGATCTGGCCCGAGCAATCGCTGCTAGCTGCAATTCAGCACGTTTGGACGCTGGAATCGG
AGCAAGCATATCGAAACTTGAATCAGCGAAAAGCGTGGACTGAGTTAACAGACAATCTCCACTTCAATATTGAATCTGTTAGCAAAGAGATTAAAGTGGC
GGCGTACCCGCATGCAAAGGCGACACTCGCAAATGTGTTGCTGCTTCTTATGCAACTTCGTGACGTGAGCAGTGATGTACTTAAAGAAACTGGTGGCACG
TGGGTAGAAGAAAGCTTTGATAACTCCCGTGAACTGCGTAGTAAAACCCAGCAGTGCACACTCCCGCGTCCTTCACCAAGTCTCACCTGGATCGCACAAC
CACGCTTTTATTTCATCGACAGTGTGCTCAGCGTGACGATGATGACCTCGTCGTATTTACCCTATGGACTTGAGTACTTAGGCAACGGGCCTACTGGAAT
TTTAGTGACCCCACTTACGATGAGGTGCTATCACGCAATAGCACAGACAGCCAGTACTATGATCAAAGGTGTATGCTTGGAGGGAGACGCCGGGACAGGA
AAATCTACGATATGTCAGCAGCTAGCCCGCTTGTGCGGTCGACTATGCGCCACATTTCAGTGCGCCAAACGAAAGCTGGCATTTGACGACCTGGTAAATT
TCGTGAAGGCCACAGCTTCTTCGGGGGCATGGTTGTGTATTGACAATTTCCAGCTCTTAGATCCCCGAAATGTGTCCATGGTCACAATATTGTGTGCACA
AGTGACGACTAGTCTCGCTGCAAGACATGCACAATGTACTATCGTTGGCGATAGAATACGTCTTAAAAGAGGGGCACTCTTTCTACTAACTTTAACAACC
CGGCAGCATCTCAATACTGTACCAAATTGTGCACCACGAGAGCGATCAGTGCAGGACGCTAAGTTCTTCTTTCGAACTGTCGTTGTGCAATCACCAGACA
TGGAAAAACTAGCTGAGTTTGAGCTGCAGTGTGGTCGATTCGTGCATGCTTCGGCGCTTGCCAAGCTTATCGCTGTTGCACTGACAACATTTGAACGTGG
ATTCGAGTTAATGAGCAACCCAGCAGAGACAGCGGGGGAATTGAAAGCTCTTGGACCTCGCCTGGTGAGTTTACGTACGGTCAAGAGCGTTGTAAAACGG
GCTACAGAACTAAACGGCACCGAGAGAGAATATCGTAGACGTATCCGGAAGAGCATACGAATCTCTCCCGATCAAGATGAAAATGAAGAAGCTCCATCTG
CATATACTGACGAACCTCTTTCTAATGATGCCGCAGCAGAAGCCATAACAAAACGTGACGAAGAGCGAATGGAGCAGCATAATGTCTACCTTGCTCTTCG
AGAGCACCTTGGCTCTATGGTGCCATCTTCGAATCTTCATTTAATCGACGCAATCATGCGTGGTTTTAATTCATTGGTATTGACAAGGGAGTTACATTTG
TCAAAGAGTGTGACGAGGACTTCTCACGCGAGCACTATGCTCGCTAACTCTGGCCTAATTGGAGCTCCGTCTAGACGAAGCATTGAAGATGACGTGGAGG
GCTACGTCCGTACAAGTGAGAGCTCATGGAAACGGTTTGGCGTGGAATTCGGACTGAAAACTGTGCAGCTTCTGCAAGTTATGCGAAATCACCGCGCTGT
TGTGATTTCAGGCGATATGCAAGTTGGGAAGACAAGTGTGTATGCCTCCCTTTCACGAGCACTCACACATATCTCGAGGAAAAAAACTCATAATCGAAGT
TATGCTCGCGCACTAGCCTTTAGCGATTCCGACAGTGAGAACTCTTTAGTTGCTCCGACTCGATGTGTAGTCATATGCCCTCGAGCACTTCGATTTGGCC
AGTTGCTTGACCTTGGAGCAGAAGATCATTCACGCAGTGTTTTCTCCAAACTTCTGAAAGAAGCAAAGGTATTCTTCAAGATCGACAAGTGCACCCAAAC
GTGGCTAATTTTCGATGGTGATCTCGACACTCTCTGGAGCGAGCAACTTATACATACGGTGGAAGAACTGCAGGATGATTTCCCGGGGTATCGGAAGGGC
TTGCAACTTTCTTCAGGGAAATACTTGAATACCCCTCCCTACGTGAGGATTGTGATGGAGACTACGACATTGATGAATGCTTCACCGTCTTTTATTACTC
GTGTTGGATCAGTGCACATGACTGAACATCACTCTAGCACATGTGGGCCGGGCTGGGAAAATGTTTTCGAGGTGTGGAAAACGCTGCGAAAACCAGCGTT
TGAAGGGTATGCAGATTTCATTTTTGCGATTCTTGATACGGTGGTCACCGAAACTGTGCCAGCTACACTAGAATTCGTAGTAATGAACTTTAACAGTTGC
GATGGTGAAACTCTAGGAGTGGTGAGGGTCCAATGGATGCTGTCGTTGTTTTCCAGTGCACTGAAGCAATCTTGGATAAAGTTTGGTGCATTAACAAGTG
ATAAGCAGCGGAATACCGCCATTCACTGCCTCTTTTTGCAATCACTCGTATGGGGTGTAGGGAGTACGACCAACAGTCTCGAACGTCAGAAGTTCCATTT
GTTTTTGTACGATTGGATTCTTCGTGGTCCTAACAGCGAGCAGTCGACACTAAAGCGATTGGTAACCCTGTTTTTTCCTAGTGGAACTTTGGCAGGAAGT
GTTTCAAGCAACGCCAGCGGAGAAAAAGCTGCAACCAGTTCCTGTATTGCTGGCGGAGGGTCAGTATCACGAAAGCAAACGATTTATGACTACGGGTTTT
CGCTTGATTTCGGCTCTAAATGGCTACCATGGACTGAGTACTATAACCGCTGGGTGCAATTATCGCTTGGATCAATATCGAGTGGCTCTGGAGCAGGGGA
TATAGGAGAATCTGGACCTGGTGAGACTAATCCAATTGGTTCCCAATTGAATCGTTTACTAGTTCCTACCAGAGCTATATGTGCAGCAGTTTGCTTGTCC
AGCCAGTTACTTCTAGCAAACACTCCAGTTATATTAACTGGCCCAAGGGACTGCGGTAAAACAGTCTGCGGATCGGCTAGGATACTTCTTAATGCTGCTG
TGTCTCAGATACCAGTCAAGGTTGACGCAGCTTCGCCTGGAAAATCTTCACCCCAACTGGAACCAATTAATTCAGACTCTCCAGTCACTGATGTAACAGC
ATCGTCTGAAGAAACTCTGATTCCTGAGAAAGTTTATGGTGGATACTACACATGTGCGAGTGAGGTACTGCTTCATTTTGAAACTGCTCTTCAGAAGATA
CGCATAGAGCTCCAAGAGAGTAGAAAACGAGAAGCATCAGGTGGGCCCGTAGCAGGTAACGAAAATCACTCCAACTCATACTCGAGTCGTTCTACTGCAC
CGGTTGGTCAAGATTCGCAGCGCGCTGTGTACGTGTTTGTGGACGATTTGCATTGCATTGATCCTGGGCGTAGAATGGATTCAGCGCTTGAATTGGTGCG
CATGCTAGCGGAGTACCAAACTGTCATAGATCCGAGCACAAACTTATTGACACCCTGCCACGGTTTTCTTCCATTCGGGACACTTCAAGTTCCGACCCCA
AGGATCCAATGCAGCTCAACGTCACGCGATATCGGACGCCTTGCACGAAGATTTGTTCCCATCGCCTTGCAACCATTTTCAGATGCTGACCTCACAACAA
TTTGTGAGAGCTTTCCTTCCTCAGTTATATCATCAAGCGGATTTCCAGCGAGATCAACGCCACCTTCATCATCTACCTTTTCTGCGGTATCGAAAGAAGC
TGAACAACTTCAATCACTTGTTATCAAGGCGAGCTTAAAACTGTACCGGCTGTTGACATCAAGCGGCGACTTTACTCTCTTTTCGAAGGAATCTGCGTTT
AAGTCGACCAAACTGCACTACAACTTTCAAGCAGCTCAGCTTTTTCAGATCGTTCGATGTATTTGCTGTGAAATTTGCCCTCCGCTGCTACTCACAGAGA
AACCAGCGTTGGCTCGGCTATGGTGTCACGAAAGCGCGCGAGTGCTAGGAGATAGTATCATGGATTCAAAAGAATCATTTGCTTTTCACCGGCGCGTCTT
AGATATTGGACTGGCAACGTTTGGTGTTACTGACGATGCATTCTTTCCTACCCAATTCGACAGCGTGGCACTTCAAAACCAGACACTCACCCAGAACTGG
TTTGCAAATGACCTCCATTTTTCATTCATCGGCGAAACAAACACCGGTGTAACCTATCGGAACGGCTACCACGAAGTCAGCGAAATGGGAAAGCTTGAGC
TCGTGGTCGAGCGCTCGATCGATATTACAGATTCATTTGCGTCGAACAGCCCGGAGTCGATGGAGATTCTCCTGTGTTCGTATGTGATTAAGCATGTTTT
ACGTGTTAATCGACTGCTACGGATGGGAAGAAATGCCATGCTGCTACTAGGCGCTCGTGGGAGGAAACTTGTCACCATCACGCGCTTAGCATGCTTAATC
TGCAAAACAGTATCAGTAGTGTATCAAATTCCAGCTCCAGCAGCAGCATCGTGGAACGAATCCGCCATTACAAGCAAAACGTATGATCATGTTACTGATC
GTGAAAAGTGGAACGCAGCATTGCGAATAGCCATGCTGAAAAGTGTTCGAGCCCATGACGCACCGACCGTTTTCATTGTGAAGGACGCTTATCTACATCC
GGAAGCCTATCCTTACCGAATTATCGACCAGTTTCTCGGAGGTCATAGCATGCCGTCCGAAATTGTCGCGCATGAAGATCTAGATGAAGAATTAGTCTCC
ATCTTGCGTGGAAACGCGCAGCGAGAACGAAAGCCACCTCAGACAGTCCGTACTGGCAGTCGTCATTCTGTTGGAGCACACCACCAAGCGCCTTCTGTAC
TTCGTTCAAAACGCGCCGTTTTAGACTATTTCTTCAATTACGTCAGGCGGAAGCTGCAGGTTGTTCTAATACTGTCACCATCATCTGTCGATTTTAAGGC
GTCAAACTGGGCATCGGTTTTGTGGCGATACCCAAACATTTTGAAGTGCTGTGACGTGAACTATGCTGACGCATGGCCCACAGATACGCTGGTGACAATA
GCACAAAAGTGTCTTGCTCAGTCCACTGCAACTACCGAAATACAGTCTTGTCTTCAGATCTCAGAGGCTGCAGTTCAGGTATATGAAGCTACGTGCCAGT
TTTTGACAAATTCTTGTAATGGTGATCCAAGCGATATGCAGAAGCCCGCAACCAAGGCAGACCTGGATCAGTACGATTTCAGCGCTGATCCATCTGGGGA
TAATGTAGCGCTCCCGTTTGTCGCAGTGGAGCCCAGTATGCTTGTAGATCATTTATGTCTGTTCAGTTCACGTTTTGAGCAACTTCAAAACTCAGTTTTA
GCCTCTGTTTCGAAGTTTAAGGCTGGACTCGAATTCATTGATCAAACAGCTCAGATCTTGGAAACAGAACAAACGCAATCTGAGTTGCTGCTTCCGGAAG
TGCGAGAAAAAACAGAACTCAGACGCAGAATGTCTGGCACTTTGGAAAGAGAGAAAATTGCAACAGACAAAGTGACAAGAGGACTTGAGCTGGCAGCTAA
AGTAGTTGTCACTCAACGTGAACGACTTCTTACTGTTACTCAGGAGTATAACGATTTGATTAAGGAATCTCGCAATATGTTTGAGAAGATGAGAAGTACG
TTGCGCATCTACCACGGCGCATTTGATCAAGATGACGATAATTCTGGTGAGGCTAAAGACGATGAAGAAGGTAACAAAACTGATGAATGTGTTGATGCTG
AACGAGAAACGAAGGTCGTCGAAGGTGTGGCAGTAGCCATAGTTGCCAAAACAGATAGCCTCGAAGAAGTTGACGTGGAATTGGTCGGTCGGCGTCGGCT
GCGTCGACTTGTCCGTAATTTTGCGTCATTGAATCGTATACCCTCCTCAATTTACCAATTATCTGAGTGCCTTGGTGTAATTCTTGGTATTGAGCCAGTT
GAAGGGCACGATGAAATGGACCCGGATGAGATTATCATGAATTACTGGGAGAATGTCGCAGTCCAAATGACTACGGCAGCATTCTGGGAGAAGCTTATCG
CGTTCGAAGTACCTACGCAAGTCACGGAGAAAATGGTTAGCGTGTTGCTTCCGATTTGCAGGTCACCCGACTTCGACCAAGATCTGTTTATGTCAGTGCA
CGAAGTCGCTGGGGTCTTGTGGGAGTGGGTCCAAAAGTGCACA