Description :
From Genome Similarity Track
Location :
Scaffold_796:8981- 9984
Sequence
1003 bases(100 bases per row)
AGACCTTGAACCAGGTCTTAACGGCCTTTTGTCCCCCTCCTACGGTTCTGGCTCGAAACCGCACAACAACCTCCGCTCTTGCTACTTCCAGTTCCGGTTA
GAACCGGGATACTCCACTTCCACTTCTCCTCTCAGCAACCCTGGGCCTCTGGAACAGCTTGGCGAGTTGTCGGTCTGGGATAGACATGTCGTAATACAGC
GCACTCGCGTCACACTGGGACTTCCGTGCACCACACCATGCTCAGGCGAGAAAAACAAGACCGAGAACCACTATCCCGGTAACTTGCACCACGAAACCAG
CAACTCCAAACCCCACTATTCCGAGATATTGCTCTGCTGAAACCTCAGGGCAAATCGCCTTCCTCCTGAAATAGGAAACACCGCAGAAACAGTAACCCCG
CGCGTGGGAATATGAAATAACGAAGCTCTCCACACTTGGACACACCACTTGGTTAACTGTAGTTGAATTTATTTGGATGATCACCTACACCCGCCTACCA
CCTGCTCCACAAGTGAAACAGTGCTTGTGGAGGCTGATCGAATGCCGCTTGCGATCTACGGGGCAATTGAACTCTGCTGAAAATGACACATGCAAATACA
AGGACCTACAGAGCTAAGAGCGCAAGCTTCCACTTTCTTTGGCTACATCTTGACTTTGGGTGAGCGACGGATGCGAATGGGTTGACTTGGGCGCGCTTGA
ATAGCATTGTGACCTATGATTGGACAATACTGGGTTGAATCTCCGGGATCTTCCAGCGTGTACGGATCTAGGCTTGTGAATGGCTAAATGGCTCCGAAGT
GTTGTACTCAGTCAGCGCGCAGCGACTGATTTGTACCCAGGTCAAACCTTGGTGGCCTCACTTCACGGAAAGATTGAGCAGAGGGTTCAGGTCGCTGGTA
AAAATCACACTGACACGGGTACTGTCTGTTAGGACACCGTCGTACTAGCGCCGCAGGTCTTGGTCGACTGACGTCGTATTGGAGCCCTTTTTGCACGAAG
CTA