Description :
From Genome Similarity Track
Location :
Scaffold_2907:898- 2394
Sequence
1496 bases(100 bases per row)
TCCAAACCGCCGGAAGACACATTCCTCGAACGCTTTAGCTACTTCCAGTGCTCCAGTGTCGCTCATCGCCTTAGCGATCACATATCCAGTGAAGTGGTCT
TGAAAGAGAAGCAAAGCTGTGTTACCTCGCTGAGCTCTTGGAAGCGGAATAACAAAGTCCATTGACACCATCTGAAACGGTCAGTCGGACATCACATTTC
CTGGCGAAAAACATCGCAGTTGGGGGTTGCTTTTGCTCGTGCTACAGTCTTCGCACCTCTGGACATGCTTGACTACATCAACGTACAAGCCAACCCAGTA
GAATTCGGCTTTCACCCTATGGAAGGACCGTACAATGCCTTGGTGTCCGCCCTCGATCGAATTGTGGCAGCTCTGGAGTACTTCGTCGATCATGGTGGTC
GGAACTACTAGTCTTAACGTCAGGTCATCACCATTGGACTCAGCTCGGTTTCTTCGTTGTCCCAAGTAGTACAAGAGTCCGTCCTCGCTGAGTACGAAGT
TATCGGCAATTTTGCTTGCATTCTGTGTCCGTCGGTGTGTAAGACCGTCGAGTTCGCCTTGGAGTACTGCTTTCACGTCTGCCCACTTTGCTTCTTCCGA
CTGAGCTCTAGATATACGTCTTCGTCTTTCAGCCTGGACGACCACTGGGTCTATGTCAGCTGAGTTGGACAGTCGATTCTCGTCCACTTCTATCTGAGCT
TGTCCTTCCACTCGGCGCATTGGTAGATTCCGTCTCATTGACTCACAAGAGCTGGTTTCCGATGTTGGACTCGGCTCTGGACCCTGAGATCCTTGAGCTG
AGTCATGTGGCATTTCATCCTCAAAGTGGACTCGGCGGGTTTGATTCCTCGTCATGACTGCCATCTCAGCTGAGTCTTTATAGTGGTCCGCTGAGTTCTT
TTCCACATATAGGACTTCTGCGATCCTGTTTAGAGTTTTGAGCTCAGCTTTGCGGGCTTCGTTGAGAACTACCCGGCCAGCTTTATTCTCCAATGCTTCA
GTAGCGAGGGAGTCGGCTGCCGCATTATAGTATCGCACTACATGCAGGTAGTGAATTGAACTCAGCTTTCCAGTCAGGTCTTTATGGCGCGCAAATTCAA
CTTGCAACGATTCCTTCTTAGATGCGATCACCCCCATGGATTGCTGGATTGCAAGCCTGGAGTCACCAACAATTATTAAGTCAGTCACCCCACGGGTGAT
GGCGACCTGGACGCCGTTATTCATACCGGCGTACTCGGCTGTGTTGACTGTGGTCGACGAAAGGTGCGCACTCGCAGCGATCTCAATGTTCCAACTTGGC
AAGCTCCACAGTATCCACGAACAGCTTCCGTAACCTCCATACTTCTCAGTTTTAGCAGATCCATCAAAAGACAGCAAATATCCTTCGAAGTCGCGCTGGA
CATGAACATACAGGAGTTCGGGGTTGAACCGGACCGTCACcgagttcttcgacggcggAGCGATATGCGCTAACGACGCTTCGAATCCAATACAAT