Description :
From Genome Similarity Track
Location :
Scaffold_453:898- 2044
Sequence
1146 bases(100 bases per row)
AGCAACGCTGCCCCCGTTGGCTCTAGCGACATCCGCTGCATTCCAAACGATTCGTCTGAGTCTAAATCTGATTCTGTCGAGGCATAGCACGATGACCCTG
TACATTCTTCTTTCACGATACGGTCGAACGGCTCGATCCCTTGGCCCAGGTGTTCTTCCTTCGGGATACGGTCGATCTACTTAGCCCCTCTCTTCGTATT
CTCCTCTTTCTTGATCTGTTGATCCGCAGGATCGTGCAATCCCGTTAGTGGAATCGGCTTCTCGAATAGTAGCCGCCCTGCCTTGATCACCCGATCGTGA
TTGAACTTAAAGCGTGTTTGTGCATCGAACGCTCCGGCCTTGAATTTGGCGTCTTGTAGCAACTGGATAAGACAACGTAGTGCCTCTAGCTGATTCATGG
TCACTTTTGGTGATGATACCGGGCCATGAATCGACCCGATCAGTTTAGGCTTTAATACCTTTAGAACTATGTCTTCTGCTAGAAGTTTCTTCAGTTGTTG
CCAATGGAATTTACACGGGATCCGTTCCAGCTGCCAGCCTTCTGATTCCGTGTCTTGACCTTCCGTCTTGACCGTTTGCTTGTTTCGATATGGATCTGCC
GTATTCGGCTTTGATCGGGACAGCTTAGGAGTGTGTTTTTTCGCCTTTAATTGGGCGGTAGTTTTGGATGAAAATCTTTCAGTTTTGACTAAAGGATTTT
CATCCGGCTGACCATGTTTTGTAACATGATCTTTTGGGGTCCCCGAATGGACCTCAGGAGGGGCTGGATCTTTTTCTTCCAGATCATCCTGGTAATCTTC
CCGTAAACTTTCTTGTCATCATAGACCCTCCCTGAACTCTAATGATATTGGAATATTTTCTCTTCATGAGTCTGCGGCGATCCATCTTCCGCTGGCGCTT
CAATCCCAGGTTCAGTTTTTATTTCAACTTCTTCATCACAGGACTCACGGTAAAATCTTGAGTCACCAGAAGATCCGGGCACGCGCAAAATCGTGGTGGA
GTGGGGTTCGCTCATTTTATGAGGCGATCCTAACTCTCCACTGGCACCCAGACGGCAGTCTAACGGAGGGGGTACTCCGATTCCGCTTGCACTTGTTCCT
TCCTCACCCTGTCTACCCGTCGGTAGGGCGGGCTGCACTCTTCTAG