Description :
From Genome Similarity Track
Location :
Scaffold_29:8974- 9996
Transcript NameFunction/comments
Hyaar_Emoy2804450DNA ligase putative

Sequence
1022 bases(100 bases per row)
CCTCCTCGCTTGCACAACGCCGCGTGCGAAGAAGAGCAGAGCCTTCATGTGGCTATTATTTTCAGACGAATGCACCGGCAGCTACGAGCACGCTCCGTTC
ACACACGATAAGCATTTTGTACTCATCGGTCTTCTTCTTCGCTGACCTTCTACTTGCTCTTGTCCTCGATGTCAGTACCGTGTGCGTCGCTGCTCGCTTC
TATAAAGTGCGGTGAGAAGCACAGAAGCCCAGCACTAAACGCAGCAAGACATGCTGCACCGTATGCTGGTCCATCGATCGAAGTAACGTACGTCCATCCT
GATAGAACTAGAGCGCGCTTGTAGCAAGTCACATTCGTGAGACATGGGAAAACGTGTAGCAAATAAGAGGAGACGAGACGAACTCATTTGACACTTACTT
GGTCCGAAGGTTCTAGATACGGACTACATGATCGTCCAGAAATAGCACAACGATCAGCAAGCGGAATACGTGTACAGGGTCAACGTAGACTTACCGTCAG
GGACGAAGAGACACCCATAAAGGTCCCTACATGTTCTTGCGAAACGAGCGTAGTTTGCAGCGCCAATGAGCTGGCACGAATGATGCTACAGGGTACGAAC
CACAAAGCGCGCGCGGATCAGATACACCCAAGCACGATGAGCGCCACACGAAGCCCCTTACCTGATAGAAATAACTTGAGGTACAAGTATCAAATATACT
GTACTGATAGTTGTGGCACTCGAAAGTGCAAAGAATGTCATCGCGTACGCGATAACCGACAGTTGCAGCACCAATATCTCGGACTTCACAAACTTTGTGA
TTGACCCAACCGAGAAGCTACCGACGAAACCTAGCAGGCCCATGTAACTCAGCATGAATCCACGATCCTTCGAATCCATCCCAAACTTGTCCTCGAGCAG
CACAGAGAAGTGCGTGCGATACAAAATAGCTGCCATCGTCAGAAGCAGTCTCGCCATCAGCAGTGTCTGCGCCGACTTGGACGCTTTCACAATGTCTCGA
ATCCCACGCAGTTTCGTCCACG