Description :
From Genome Similarity Track
Location :
scaffold_447:8973- 10493
Transcript NameFunction/comments
g8449.t1 tRNA uridine 5-carboxymethylaminomethyl modification enzyme gidA

Sequence
1520 bases(100 bases per row)
GATGTGGTTGTAGTAGGTGGTGGCCATGCGGGCTGCGAAGCTGCCGCCGCTGCCTCAAGAACTGGTACGCCGGCCCATGATTGTCAATTCTGATGAACAA
TATACTAACAGTATTTTGCATTCTGGCCTCCTTATTGCCAACTGTCATGCAATTCAGGTGCTAAAACCGCACTGGTGACGCAAAAGTTGGCAACCGTAGG
AGAAATGTCATGCAACGTGCGTATTATTTTCCACTTGTGGCAATTATCAACGGTTGTTGCAATGACTCGCTAACCTCTATGCAATTTGAATCATAGCCTT
CCATTGGCGGTGTAGGCAAAGGCACTTTGGTACGCGAAGTGGACGCTATGGGCGGTCTCATGGGGCAAGTGGCTGATTCGGCCGGCATCCAGTTCCGGAT
GCTCAATTCAGCCAAAGGACCGGCGGTGAGAGGCCCACGAGCTCAGATGGACCGAGATCTGTATCAACAGGGTATGCAGAAGGCACTTCAGGAGCTGCCG
AACCTCTGGCTGGTGGAGGATGGAGTGAACGACCTCATTTTGGAGAAGCGGAATCAGGGAGAGCAGGTGAAGGGAGTGGTGACATCTTCCGGCCGCGAAA
TTCAGGCGTCTCAGGTGGTTATTACAACGGGCACGTTTCTCCGGGGAATGATTTACCAAGGACCCGATATCCGAATCCCGGCAGGGCGACACATGCGCGA
CTCGGACGGTCTCGAGCCACCGGCTGTGGGTTTGGCGCAGACGCTGGAGCGACTCGAGTTCCCGCTTGGTCGTCTTAAAACTGGAACTCCGCCACGACTT
GATGGACGGACGATCGACTACGCCGGACTCGAAATCCAGCCCAGCGACGATCCGCCGATACCATTTTCGTTCTTGAACGAGCACAAACAAGTGCCCCTCG
CGGACAAGCAGGTTGCTTGCCATGCCACATTCACCAACGAGGAGAGCCACCGTATTGTCCGTGACAACTTACACATGCTTCCACAGTACGACGGTGGCAG
GGATGGGGAAGGTGTAGGCCCTCGTTACTGCCCGTCGATCGACACCAAGGTCATTCGCTTCTCTGACCGCTCAAGACATCAACTTTGGCTTGAGCCTGAG
GGTTTGAACACACATTTGGTGTACCCTAATGGTATCAGTACTGCGCTACCTGAAGATCTACAAGTTGAACTGCTGCGTACCATCAAGGGACTTGAAAATG
TTGAAATTGTGCGCGCTGGGTACTCCGTTGAGTACGACTACGTGGATCCGCGATCTCTTCACCCAACGCTCGAGACGAAGAAGCTACCGGGACTGTACTT
GGCCGGTCAGATTAACGGCACGACGGGATACGAAGAAGCTGCTGCACAGGGTATTGTGGCTGGTATAAACGCTGGTCTGAGTGCCATGGGGAAGGAGCCA
TTGGTCCTCGACCGCGCTGACGCCTTCACAGGCGTTCTTATCGACGACCTGATCTCATTGGGCACCACTGAGCCTTACCGGATGTTCACTTCTCGATCGG
AGTTCCGTCTGCTGCTTCGC