Description :
From Genome Similarity Track
Location :
Scaffold_508:897- 8124
Sequence
7227 bases(100 bases per row)
GTGATGACTGACCTGAAAGAATTTTTCAGGGCGGAACCAAGACGAAGAACTTGTCAGAAGGTGGTTTAACTAGATGAATATTGCCTTCCTATGAGATCAA
GCTTCCGATGATAATTTTTTTTGGTATTCGGAGACCTGCTGACAAGACCGGCGCGGAATTGGTACAACCAGTTGAGCCGATCGACCCGTAATCAGTGGAA
ATCATTGTCAGAAAGCTTCATGGTCCAATACGGAGGATATGGAATGTCAGCAGGAAGTCAATATTACCATGCGCGGAAGCAACCGAATGAGACCCCGTTG
GAATATCTCCACCTGCTGAATATGGCAGGAATGTGAGCTAAAGTGGCGTTCAGAGATGGATCGCCAGCTTGCCGACGTGAGAATGTGGAGCATTTCATTG
ATACTTTAAACGATCGAGAGCTGGCGAAACAACTGACACTATTGCGAGTACATGAAGCTAACACGATGGAAGAAACTCTACACGCGTATCAGCTTATGAG
CTTTCGACAGAATAAATATCCGGCCGAATCGAAAAAATTCCGATCGCAATCGGCTAAACGTCGGCTCTGGTATATTCAAAAACACCCCGGGCAGTGACAT
CCATTCGCGTAAAGTGAAGAAGGCGACTCGGAATCAAGCTCGGACGGATCTTATGAAGAATAGTTTTTCCGCAAGGTCTGTGTGACGACCACTTCCGATC
AGGTCGCAGATCCGGGAGAGCAACGATACAGATTGCGGAATACAGACCGGGACGATGACCGCGATCGCGTCGGGCTTTCTAAAGCCTGCACGCACTGCGG
CTCGAAGAGGCATGATAATCGCGGATGTTGGAAACGACTGACCTGTCAAAAGTGTGGTCGCAAAGAACATCCCTCGGAAAAATGCCTGCATGTGTGTCCC
GCCTGTGGGGAGGTTCATGAGAACGGCCCCATGGAGGAGTTTCACAACCTCATCCACAAGTGGTACGTACCGACCCATCATTCAAGGCTACTCCCGACCA
AGGCGGAGGAGATAATAAACTAGGACGCTCCGCCAGGTTGAAATCTGGCACGAGCCTAGCGTTCTAGTCTATACATGTATGCATTTGTGGAGACGGAAAG
GATCAATCAGAGGAGTAACAATCGGATCGGCCCGATCGCTAATACATGTGATTTGGATAACCATCGTCTGCGTAATTTTTCAGGTGTGAAGAGGGTAGAT
GAACACTCGCGATCTCCCGTTAAGATGGAGCTCGATCTAGCTCCGAGAGAGTAGCGAGAATATTGAAAATATCACACACCAGAAAAGTGATGTAAACAAG
CTGAAGAGGTGATAAAAATCAACAACGAAAGGGCCACTATGCTATTCGATTATGGAGCCGAAGCCTTAAATATCGACGCTACCTTTGCTCGTAAGGTGGG
ATGTATGATCGATGATATCCAGAAGCAAGAATGTGTGGGAATTGGTAGAACGCCTACATGACTCAAGGGAGCACCAAGATCAAGATCAAGATCACACTAA
ACGTATCGCTGGTATATTATTTTGATGTTTGGGTGGGCGATCATGTTGGCCAAGAAGCAAAATCTTAGGTATGGATTTTATTGCCAGTAGGGATACGGTT
CGATCTAGCGAACGGTACGATTTGCTTGCCAGACGAAGTGAAAATCACCTGGCAGGGCGACGACCTCCATATAGAGTAAATATACAACTGATCACTGTTC
CAGATCAGCATGTGGTAATCCCAGTTGAAGGATTTACTGAAATGAAGATTGGAGCAGGTTTCTTTAAATCCAAACTATGGGTAAGTTGTAGGACAAAAAG
TGGGTGTCGACGGTTACTTCTGGCCCCGGTAGAAGGAAATCTAGTCAATATCGAGTACGAAGACGCCCCTTGCAGTGAAGAACAGCGATCGTTAGACATG
CTACTGCGGTTATTATGATTGCAAAATGGCGATCCGACACGGGGTCGGTCGGTTGAGGCAATCGGACAAGCAAAGGCGGTCAGACCGAGGGTGATTGCTG
GGATGAGGGAGATCAGGAGCAAAAACCGTCAGATTAAGGTAGTAAAAGCGCTACAACGCCCACGATCGAAGAAGATTCAGCGGAAAAACTTCGACGAAAA
CTACGGTATATCGCCATGACACGGATGACCTGTTCGCCGAAGACGTCGACCAACATATGGCGATCTTGCCAGAAATAGTCGTTCCCACGGCAGATGTTGC
TATCGAAGACATCCAGGTTAGAGATCCAGGTATACCACTGACAGATGATCAATAGAAGTTGATGCAACTGAAATAGAAGAATCGCCATTTACTCATAGGC
AAGGGGAATGCCCTGCCTCCAGCTGCGCGTGGAGCGGGTATGCGATATTTATGTCGGAAGTGATAATCCGATCGCGCAAAGAGTACGACCAGTGGCAACC
AAATATCGAGAGAAACTGGCGGATTTAATTAAGAGACTTCTGTCGGCCAAGAACATCCAACCATCCATTTTACCTTGGGCTTCTCCTATCGTGGTGATCA
TCAAGAAAAAAGGGGAAGATATACGACTATGCATTGATTACAGGAAGATGAACCAGTTGACAAGATTGACGATATATTCCATACCAATGATTAGAAAATT
GCTGCAAGACTTGGATAAAGCAATGTGGTATTGTTTTTTGGACATAGCGAAAGGATTTTGGGTGGTGGAAATGACAGAACGATCAAGAGCTATATCCGCT
TTCGTCACGCCTTCGGGTTTGTTTAAATGGTTACGGATGCCTTTTCGGTTGAAGAACGCTTCCCAGATCTACCAGCGACTGATCGACAATTCATTATATG
AGTATCTGAAAATCGGCCCAAAACCTTACTCGAGTACAACACCGTCGTCGACGCCAACAAATGTGTTCACTGACGGAGTGCCAGATACGGACCCAAGACC
GTCGGTCCTAGGTAGAAGATCATATATTGACGACAGCTTGATATCTGCTACGTCATGGACTTCCTTTTACAGAAGGGTTGAACGACTGTTAGAGGTGTTT
GATGAATGGAACTTATCGATCAGTGTGATCAAAAGCTTCTAGGGGCGTCGTAACGTCGACTACCTAGGCCATCAAGTTTCGCTTGTAGAATTGGAAGCCC
ACTCTAAGGTTTTAGTATAAATTATGAATATACCCTTTCCTCCAACTCTACGATGGATGCATTCATTCTTGGGAAACATAAATTACTAGATTCGCTTCAT
TGAAGACTTTGCAACATATGCCTCTGTGCTCTATGATATGCGGGAAGCTGATTTCCATGAGATTTGCCGTGACTAGGACTTCCAGCTGTCTATATCAAAG
AACGAACCCATTCGCGATTGCGATTCACGAGAAGGGTGCGAACGCATTCCTGACTCAAATGCAGAGGGCGATCTGGACCAAAACATTGGGGCGATCCGAA
TTCCGGAAACAGAAGTCGATGGAATAAAAAGGTAATAGCTCTTACTCTGCTAAAGGCTAAAATTGCTAAAACCCTAATCTTAAAACATTTCGACCCAGAC
CGATCGCCTGTGATTGTGGTATACGCCAGTAAGTGGGCTGTATCAGCTGCATTACTCCAGGAATACGACGGCATATTTTGGCCAGTCACCTTTTCTAGCC
GCACGCCGAAGTCCAATGAAGTCAATCATATAATGGTCGAGAAAGAGGTCTTAGCTCTCCTCCGAATATTAGACATTTGTTATACGATGTTAGTTTCACG
AGAGACTATGGTATTTACGAGATATTCGACGTCGGCTTGACTATTGCAGTCGTCTAGTCTCAACGGAAGAATATGGAGATAGGCAGGGCTACTATCAAAC
TGGACTTAGAGATCCGAAGATTTGAAAAAGGTGAAGACGAAATGCTGGGTATGCTGGCCGCGAGTGTGACACCCCGCAAGGACGTAGACGAAGTACCGAT
CGCGATTGCTCCAAGAAAACAGCCACGATAAACCATAGGCATGCCACCACTTACGTTCGAAGCAGACAAAAACCTCCTGGAGGTTAGTTTCGATGGATCG
GCTAGGGTAAAGAAGAAGGGCGGCGCCTACAGTGAGATAATGTGGAAGTTACCTGAGTCGATGATCGTGGGTGCTATTTCCGAGTTTGCAGAGAATTTGA
CACTAAATGAAGCGGAATACCGTGGACTATTGCCTGGCTTGGATTTACTTGCTGATCAGACTAGGGGCGTGTGATCTTTTGTGGTGACACGAACTTGGTG
ATAAGGCAGATGCGGGGCGAGATTGGTTGTAAGGTACCATGTTTGCACTTGCTGTGGCATAGGGCAATGGAGAAACACCGATCATGACCAAAGCATGAAT
TTCCTAATATAAACGGGGGTGGAAAAAGAGTGCTGATCGGCTAGCGAGCGAAGCTCTACAGTAAGAGAAGGAGGGGTCATGGTATCAGACCAGGAACGAA
ACAATCTCATGATGCTTAATCGGTTGAGTAAGTTACTGATACCAAGACAAGGCTTCCTCCCAGTCATGGTGGCTGCGATCACTCGGTCAACGACGCGAAG
ACGATGTTCCTTGACAGTTTTGCAAGAAGAAATCGTACAACAGGTCTGGATTGAGCGCATAAATCGTGCGCAAGATGAGGAGAGTTGGATATCTGACTTG
AAGACGTATCTGATCGAGAATATAGACAGGCTGAATGCTAGAGAGGCAAAGATTTGCGCCCTAATCGTACCGGACTACGAAGTCGACCAAAGTGGCAATT
ATTTATCTGTCCTAGGGCAGCAGCAAAAAGCGAAGAATGTGGTGAGTCGGTTCGTCTGGTAATTCGCGAGTTGTTGCAATGAGATGTCTCACATCATTAC
CCCACTAGTTTGGAGGGCGGGCACCAAGGCGTAGACCGCACATATCAACGGATTAGGACGAACTTCCATCGGCGGAGATTGTACCGGAGGTGCAGCGCAA
TGAACGCGAGTGTGTAGATTGTGAAACCGGCAAGGGTCGCCTGCATGATCGAGGTGGGTCACCAGAAAACTTACAAGCGGCTTATCCATCTCAAGTTCTG
GCCATGGATCACATCCCGTCTCTACCGCTATCGTTTAGAGGAAATGTAGAGTTGTTGCTGTGGATCGATCTGTTCTCGGGCTACGTGATAGCAAAGGAGA
GCTCGTCCCGGACTGCACAGAAGATCACAGAAAATTATGTAGAATGTGTATTTTGAAGATTCGGTGCGAGTGAAGCCATCCGCCATGACCGGGCGCCAGT
TTTCATGTCCAATTTATTCCGAGCGTTTAAAAAATCGCGGGACAGAACCAACGGGCCTTATGGTGTATTGACCTCAAGCGAACGGAATCGCAGAGCGCAT
CGTACAAACTCTGACACGATCGATTAAAATGTACGTCACTGATGAAAATCAGAGAGATTGGGACGAATATGCAAAGAGATTAACCTATGCGATCAAAACC
ACGCAAGATCTTGTTCGCGGAGAAACGCCGTTTTACTTGATCCATGGCTGGGACTCGCGAACGACGTTAGAAGCAACCCTACCAGTAAGAAAAGCACTTC
CGCAATCACGATCCCAGAAGCTGGAGGTATAGTATGCAGTGCCAATAGAGAGAGATCGTGAATGAAGACAATGATTCAAGACAGGGCGAATCGTCATAAC
GAAGACCTCAATCTTATGGAGATAGATCAAGGGTCACAAGTATGGCTATATTTGGATCGCGTCATAGATGGGTACGCTCGAAAGCTAGATCATATGTGGC
ATGGACCATTTCGGGTAGTTTAAAAAAATACGGCGACCACACAGTGAGATTAGCAGTCGCAGGCACACCTTATCAATTGTTCCCAGTGGTTCATATGTCC
AAGCTGGAACTGGTGAAGACGTTTCTAAAGCAGCCCCAGAGTCGATTTAACGTAGGCAAGTCCGATCAAGTCGATTTTTGATGAAGCCTTACTATCAGAG
GATAGTTGGGAAGGCGAATTAGAAGAGGACTTGCTTGAGGTAAGTAAATTGTGGATTTGCGATCAGGCTGAAAAACGCGCTACAGGCGAGTATAACGTCA
ATTTTGGTACATTAGAAAGTTCATAGCGATCCGTCATGAGTGGATGAAGCAGACTTGAATTGCGGCGCTTTACTACAGAAATTAGATCGCGACCGAGTAA
TCCGGAACCGATTTGAATTGATGCAATCACATGAAGAAGAGCCAGGGGCCTAGACCAGATCAGGGTGGTCGGAGTATGTAAGTATGCAAGGGGGTTGTAT
TGTTGTAAGGTGGAAAAAATTGCACCAGGAGGAAGGGCTGTTTGTCAGTGTGTGTGGCGATCGGGATACCAGGGCCCAAGGGCCTGATAAAAAAGAAGAC
ATTCCAAAAAGTATCGACAACGTGGAGAAATGAAATTGAGACTTGTAAATGTATTAAATTAGATGGACTATGGAAAGACGAACTTACCGGCTAGGCGAGG
GATCGACATGCCTGAATGATCCGCGATCGAACCCAGTACTGATTGAGCCACGGCTCAGCAGAATTCGTCAACAGTTATGCGGAAGCCAAGTTGGGGATAT
TGGTTTTCCTAGTCCCCAACCCAGGATACCAAAACTGCTTCTTAGTCAAGCGAGGTAGATACAAGAAAACCTGGTCCAACAGAATGTCCATGTCACATGG
GCCTTCAATCTTCCCATGGAGTATGAATTGGAGAACTATTTTCCAGCGGGGGCCAGTTAGTGATCGCCGCTGCTTCTTTTGGTCACAAGGTGAAGCCAAT
CCCGGATCGCGAACCCGATCTGCGGAGGAGTTCGGCAAAGTGTGAATCGATTCCTACAAGGTCTGGATATAGCGATTCTGAAAGGAGTGGTACATATCCA
GCACTGCTTGAACCATCCAATGGGCTGGAAGCACATGGGCGAGATCCTTGTCTTCAGAGATTTCCAAGATATATGGCGGTAAAGCGTGTCGATCTGTGCT
GAGGAAAAATTAGGCTAGAGGACCACTCCGACATTGGAAGTTCTCGACACACTGGAAGAAGCCGAAAAGCAATAATACTTGGGTCTTGCAAGATGGCGAT
AGAAGAACCCCGAGTCCAGCTCCGACCCGCTGATCCAGCTCACCTGGATGGCGGACCAAGATGAGACTTGAACGAAGGATTTTGGAATGCGACGGCGATA
CCCGGTTATCCACTGATAGCGGGTCACTTTGGTCTTGGCAAGAACATCATACTCGGCCGGGGGCAAAACGTATTGATAGGGGCTCGGGCTTCTACCGCGA
CACTGATCGCGCAATCCGAACTGCTGG