Description :
From Genome Similarity Track
Location :
Scaffold_718:8968- 10587
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_718-snap-gene-0.7Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_718-fgenesh-gene-0.4Appr-1-p processing domain protein

Sequence
1619 bases(100 bases per row)
AGCGGATTAGAGCCTCAGCAGCCGCCTCGAGCGAAGCTACAGGCGCTGCGAATGCTGATCGCGCGTCAGAAATGGACGAGCAACAGTCGGCCATCAGAAG
AAGCAACAAGCGTCCGTTTACCTCCTCCGTTCCAGCATCACCGCCGTCACCGGATGAAACAATAGTGTCTCGACCAGTTTCCAAAGCTGGTGACCAAGGT
GCAAACACCGCGATGGAGACAACATCCGGACACTTGCAGCAGGAGTCGTCGAACGAAAGTGTGTCAGGACATACGCCTAAACGGAGGCGTCAAGAGCCAG
CGCTCAACCAGCAACGATTTCCAAGCGCGCAGTCGTCGCCCGCAGGTGGTTTTCAAGCTTATGCTCATACCTCTCTATCTGGTCTCAGCAGCAGCCGTTC
GGGAATCTATTCGATGTTCTCTGTGGCGCCACCCGGCTCGTCTCAATTGCGTGGCTCGAAGCGATACGAGGCGATGTTGCCTGCACTCAACATGGACAAG
TTGAAGCAGCTGCTTGCCAACAAGAAACAGTAAGAATGTGAGGGCATTGGCGGAGTAATAACGGGTGCAAGAGGGCAGTCGCCACACATTGAGTCGGTGC
CACTGCACTGTTCCAACTGATCATCCGGCCAGCAAACGCTGATAAGCGTATTTATTCGTAAAGGCAACCGTAGTTACCGTTCACCAATCAATGGACTAAC
CACCAAATCAAAGCGAAACGTGGACACATCACCTTCTCCAGCATCTTCCTCACATTCTCCATCGACAAAATGCATGCAGATAACGGCATGCAACCACCTC
CTCAGTTGTTGTCGTCGTCATCGGCATTGTACGCGAGCACATCGGGATAGTCAAAGGCGTCGGCGTGCAGACGCAGCATAATGTCACGCTTTGTCTGCTC
GAATTGAGTGAAGCCCTCGTCTTCAAAGCACACGAACGCCACCTTGGTGCGCCAATTGCGCTTGGCTCGCATCATGTCACGTACGGCGGCGAGAGCAATA
GGAGCAGCGCGGTCGTACGGGAACCCCATGAGCCCCGTCGAGATGGACGCGACCGCGGCGCACGTGACGTTGCTGTTGTGCACTGCAGTCAGGGCTTCCA
CGTACGTCTTGTACAACGTTCGGTCAGCTTCAGTCGTTCGCGTCGCGTAGGGTCCAGCGCAGTGCACAAGCAGCCGCATGCCGCTGTCGTATCCCGCGGT
AGCCATGACGGAGCCGGGAGTGACATAGTCTGAGAATCGCAGATGAACGACCTCGCGATCCAGTGACGGCCCTGCGCGCTCGTGCACGCGAGCGGCAACG
CCAACGTGTGGGTTCATGAACGAATGCGACGTCGGGAATACCAGGCAGTCAATCGCGACGTCCCCAACGTGCGTGATAGTGCCGATATCCCCCTTCACGA
CCTCGACAAGTCCGCCGAAGCCCTCCAGTTGCCAGCGGAGGCTCACGTAATCCTCGAGCGCGCGGCAGCCCAGCGAAGTCTCATGCGGGTTCAAAGCCCC
GAGATTTTTGGTGGCCGACCAGTCGACAGGACAATGCTGCGTCATGAAGCGCGTCCACTGCGCCTCGTCCGCGAGAACCTCCCTCGCCGTACGGCAGACT
TGGAAAGCACGGCAGAGTG