Description :
From Genome Similarity Track
Location :
Scaffold_20:896382- 900736
Sequence
4354 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTATCGGAAGATAACCTCCTCTAGCTCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGGAGTTCGTTGCCATGACTTCTCCCATATGAACGACTCTCAGTTCTAGTCGGTTCGGAAAATGGCAGGCATCTTCGGGATGGAGGCC
CTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCATCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCCCATGTGCGGGAGAACC
TGCAGGCTCCGGCGGCGGAAGCAAATCCACCTCACTCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACTTCTG
GGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCGTGCTAAGAGT
TGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGT
ACCGTCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGATTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAA
CCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAA
GAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGACTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAA
CAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTG
TCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGAGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAG
TAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGCCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCT
CGAATCGGCGAAGTGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAG
AATTTCGCACGCAGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGAAACGGGACGGTGTCAGTGCGACTGGCCG
ACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCC
ATATGATATGATCCTGGGCCCCTGGCTTGAGAAGCACGAGCCCCGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGA
GCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCGGCAGATGCTTGGGAGTCGTCGACGTATATGACG
ACTCCGAGGATGCTTCAATGGTGGCCGCACCCAGAAGAGGCGCCGGCCAAGTGGGAAAATTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCTGC
AGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAAAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCT
TCCTGTGTGGGTAACCCAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACG
AGGCCACGAGTTCCTCGGATGTCGTCGCGACGACATCCCTAGACATGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACGCCGCCGCCGCCT
CAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCTAGGGCCCGGGCTCTTCCGACAAGGCCGGTGGAAGAGTGTTATCAC
ATCTTCGAATGCGAGACTGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAGCCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGG
CTGAGTCTTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTT
GGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCTGGTGTATCCTTTGGTGACG
GAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGACACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTG
TCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCC
GCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACA
CCAATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGATGGATACTAACAAATCCTGATGCGAG
AGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCGCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAA
TCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCC
ATGGAGGTGCATCTAGGTCACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGA
TTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCATTCGGGCTGACCCAGACAAGTTCAACGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGA
TCTTCGAAAGTGGTTGGGCTTAGACAACTACCTTCACAAGTACAGTGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACATC
GACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGTCAGCATCAAGGCCAGCCTCTAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGATGAAGCCGT
TTAGCGTCGTCTGTGATGCCTCTGATTACGCCATCGGATGTCCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCA
GCTCAAAGCCACCGAGCGGAACTACCCTGTCCATGACAAGGACCTCCTGGCAATGAAATATGCCCTTATGAAGTTCCGTGTTCACCTTCTGGGCTCTAGG
CCCTTTGTGATCTACACAGACCACGCGTTCTCCAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAAT
ACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTACGAACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGAC
AACGGATCTATATGATCGAATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTCTCGTCAAGTTCCTTTAGGCCGGAACGAGCGCGAAGTCCGAC
TGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAAGAGGACCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCG
TACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGTCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTC
TCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAATAC