Description :
From Genome Similarity Track
Location :
Scaffold_82:89626- 91608
Transcript NameFunction/comments
g7158.t1hypothetical protein

Sequence
1982 bases(100 bases per row)
ACGGAGAAAGATTTAGAATGTCACGCGGTCGCGATTTTGATAGCTAGCGTCCAAGTCTCGAGACACTGCCAAAGGTGGTTAGCATGCACTCGATAAACGA
CGGAGCGAACAGGAAGAGTGAAATGGTAGTGAGGACTATCTTCGCACAATCTCGTTCGTACTTAGTCGGAAGTTGGCGCCCTTTTTCCTTTTGCTGGAAA
CTGCAACAAATAGGTCGGAAGAGGCTCCGGACTCCGCATGGACAGCTCCCGAACGCCCAAGCGCAAGCGCCGCCGCCTGGAGTCGCGGCGCGCCGGCAGG
AAGGCGTCAACCTCCTCATCCTCGGCCAGTCGTGCCGAGTCCCAAATCGTGTGGAAAGACTCACCCGCCGATAAGCAGATCAAAGTGTCGGGCACAGGCA
AGATGGCGGTGCGCAGGGAGATGCAGGGCTTCGTGGGGCGTCTGGCGCGCGCCAGTCAGCAGTCTCCGCCCTCCAGTAGTGACGAGGACAAGAAGAGCAG
CCGAGAACGGAGTCGCTTACGGCGGGAGGACAAAGGTGAGCAATGATTACTGGTTAAAGGGAATATTACTATTGATATAACTAATTAGGGGATGCAGCTA
CCTCGAGACACTTGATGTTCAGCCCACCGGGCCATGTCCAACAGACTCTCAACACGGTGAGAAGAAGACGCTCTACAGAGACAGGAGAATCACAGGACGA
ACTGTTCAGTGTGTTGGACCAGATGGAGCAGAAATATGCCAGTCCTGATGTCACGGGCACATTGACGGCGGCTTCTAGGCGGCCACTGCCTCTTGCAGTA
GCTGCATCTACGCAGGACATGAGCTTGATGCCCACTCTAGCACCCAGTAATTCATCTACTGGAACAGTCTCTCACCGAGCTCAGGACGCTGGCAGAACTC
AGGAGGTGGCCGAAATACAGAAACTCCCCAAGACCCTCCCGGTCATTAAGGAACAGGAGACTGCCAAAACGCCGCAGAAGTCAGTGGTAGTGGAGGCAGA
TACTTTTGACGATCTAACAGACGAGTCGTGGGCGTTGGTAGAGCAGATGGAGAGTCAACGAGCACCGGTTGAGATCTCACAAGCACAATCGCTGTCGCAA
ACGGAGCTCATGTCGTCTCAGAGCTTCGCATTGACTCCACGGCCGATGCCGTCGGCAGCGTGTGGGGAATCGAAAAAAACGCCACCGGTACTGCCATCTG
CCGCTCCGCCTTCAGTGGTGCGACCAATGCACGGTGTCGATGTAGCTCAGCAGCTGGAGTCGCCCGAGAGCTTCAGGCGCTTTCTGGTTTTGGAGGTGGA
TCGCAACGTTGTTAACCGTTCGCTCCTACTGCGCCTGCTAGATGATCAAGACGTGCAGCTGGAGGCTATGCTGATCGACGATTGGTATGACGTGCTTGTC
GAAGCTGGCGATACGATCAATATTGTATTTACTGAACAGGATAGGGATGGTTTCTTCTCACAAGACGGGCACAACGGATCAGTGGTGCGTCCTTCGTCAC
CCATCCAGGTGGACAACACGCACAACGTAGTGGTCGTTCACCCGGATATTCTGGTGCGTCTAGGGATTCAGTGGCGAGTAAGATCTTGTGTTAAAGATTT
CTGTTTTGCTGGTTACTCTACTGCAGGTATCGCCAACTAGAGTAACAACTAGTTTCGGTTGCTTACGACGCGCAGTTTTGCAAGAAACGCTCGCTGTGAC
CCGGCCAACTGGCGAGAAAGCGTTCTTGGGTACATTAAAACACGACTTATTCGAGCATGCGCTTCTGAACAGTATTTACAGCTCCGAGACCCTCCTCCAC
GAAGCCAAGCGGATCGTTAATTCCAAGTACGAGCTTTCATTGTTGGGCATACTTGATCACTTGACTGACGAATGCCGTTTACGTATAAAACAGTATTTTA
GGTCTAGTCGAATGTGGGCTGAACGAGGAAAAAGCACTGCTGGAGCTAGGTAAGGTGATCGACGATTATCGGTCATGGGTAT