Description :
From Genome Similarity Track
Location :
Scaffold_482:8961- 11522
Sequence
2561 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGTTGGTGGAACGTCAGGAGATGAA
ATCTGAGGAGCAGCAACGCACGGGCGCTTACTTGGGGGCGAGACGAGGTCAACCACCGATTGCTCCTTTCGCCGCTTATAAGCAAGTTCCACTGACGGTG
AAAACCCGACAACAAAGTCCATCAGATGAGCCAGTTGAGCGTCACGGTCACGGACGAGGATATCCTGCTCGGCCTTCAAAAGTGCTTATTCCTCAGTGAT
GGCAGCAAGGGTAGAGCGCAAGCGATTGAGCTCCTGGTCATAAAGCGTAATAAAAGTATTCAGAAGGTCGATATCACGAGCTTGTTCAGCCACATTGCAG
GCGATCAAGTCGTATCTTGTCCTGAATGGATCCAGGAATTCTTTACCTTTCTTCACCTCGTGCTGCAGATCAGAACATTCCTGGGCCAGTTGATTGGCTT
TGCATGCCACTCACGCCATGCCGCACGGGAACATTCATATTTTTACTGAACGAACTGCACGAACGGGGACGCTATCTCAGCCCACCCCCGAAGTTCTTGT
TCAATCTCATTACCACGTCGTTCTTGGATTCGTTTCGCCGTCATCAGGTCCTCGTACGAATTGGCCAAGTCCGCTTGGAAGGCGATACGACGGTACAGCG
ATATAATTAAGATGGCCAACGAGTTGTAACCATCGACAGGCGGAGGCCCTACTCGCAAATCGGTAAAAAGAGAAGGATCCACATGGTTCACCACCATATG
ACCACGGCCGGTAGCGGGATGGGGAGAACGATCATTAAGTACGATGACATCGGCGGCAAGATCAGCATCAAGAGCGGCGACGACAACCGGATCTATGGTC
CGGTCAGCAGGAACGTCCGAGGCCTCAGCAATTACCGCGCCTGGGTCGACGGCACGATCATCAGGAGCAGCCTCGGTCTGGACAGAAGTGTGAAGTTTGT
GCTTGATCACTGGCTCCCTCGCCACTGCAACGCGAGTCGAGGTCGGCGGAAACGTCAACAGGTAGAACCGCGACGTCGACCAAATCGACGGGATGATTAA
ATGTAGCGCTTTCGGGTTCGGCTGGGGCGTGTCCCGGTCACCACAGACCTCGCCAACGCGGTGCGATTCAAGGTCGGCTGGGATGTCAACGAACACGGCT
GCGATGCCGCCTGGGTCCAAAGGGCGGTCAGAAGGAGAGGTTTCGGTCTCGACAGGGGTGTGCGCCTGATCTCCGACTGCAGTGCGAGTCAGGATCGGTG
GACACGTCAACAGTTAGGGATGCAACGTCGACCGGACCTACGCGACGATCAGATACAGGGCTTTAGGGTTCGTCTGGGGCGTGTTCCTGGTCACCGGAGA
CCTCTCCAACTCGGTGCGAGTCAAGGTCATTAAGAACGACATTGTCTACGGTCGCGTCTAGCGCATGACCAACAAACAATTCTCCACCAATTACTGGGAT
AATGGATCGCAGTGGGGTCGACTGGTGGGGCATTAGACCCGAAACCAGAGGTAGATCGGCGGCGAAGCGGTTTGGAAGCGACAGCTCTCCAAGACTATTG
GATTGTAAAAGGTGCGGTGACTGGACGGGATAGACAAATCAAAAGTGCTGAGTCAGATCTACATTGGTTGTCGACTACCAGATCAGGGGACAATTGTGGT
GGAGTGGTCGGGAAAAATCCCGACCAATCGCATCTTTTCACACCATTAATCTATGTGGGATCGGTCATGAACGCCTTGGGACTGACCTCCGGAAAATATC
CATTGTTACGGTGGAACGCTGACAGGTTATGATCATCCGTCACGGTCAATGACTGAGAACTTTGATATCGATCATTGAATATGACCAGAGGTCATTGATT
ATGTGGCTGATGATTTGTTCCCCTTCCGATTGTAACTATCTTGCGTGCTGCCTGCATATGAGCTCGCTGCATATATCTTGGATTGATCACGATGAAAATG
AGAAGCACTGATGGCTGCTCAATGAGTCTGATACTGTAGTCGCGTGTCGCGCCAACGTCGA