Description :
From Genome Similarity Track
Location :
contig_15:896019- 898474
Transcript NameFunction/comments
g4371.t1hypothetical protein
g4372.t1RAW32501.1 hypothetical protein PC110_g11167 [Phytophthora cactorum

Sequence
2455 bases(100 bases per row)
GGACGTGGCCTGGAAGTGCACGGCGGCGTTCGTGCTGGGCGCAGCGGCGCACTATTCGTGTCCTCACAAGTACTGGGCGATGCATCATTCCTCAAGACCC
CAAGTAGCAGCATCAGCGACAAGGAGGAGACCCCCGAACCCCCGTCCAGGTCCTCGTCAGGTTCGTCAGACGACTGGGAGGACGAGGGCGAAGCCTCTTG
GGTGCCTCACAAAATGGTCATGTGCGTGCGCACCGACCTGAAAATGGGCAAAGGTTGTACCCACATGGATCAACTTTTGGGTATATCATACTGACGCAGT
TGGATTGCCAGGCAAGGTCGCTGCGCAGTGCTGCCACGCGACACTGGGCGCGTACAAGCGGGCGGCGAAGCGCACGCCGACGCCATCGAGCGTGGGAGAT
GCTGGGTCAAGCCAAGGTCTGCCTCAAGGTGGACTCGGAGGAGGAGATGCTGGCGCTGGCTGAGAAGGCGGCGAGCACGGACTCGTCAACTACGTCGTGG
TACGGCTCAGTTTCTGTGTTCGTGTGTGGAGACGTGAGTGTTGATGGTTTTTGTGTGAGTAGATTGACGCCGGTCGGACGCAGATTCGCCTGAGAGCAAA
GACGGTGCTAGTATTGGACCAGCGCCGCTGAAGGCAATTGACGAGATCACGGGCCACCTCAAGCTCATGTGAGCGTGAACTGAATAGGGATAACCCAGGA
AGAGAGACATCAACTGTGTCGGAGTGAACTGATGGTGTTTGTATTTAGCCTTTTCCTGTCTGCTGTGATGGCAGAGTGGAGGGCGGTCGCTAGAGCGTAG
CCACGGGATCGTACTGCGTGCGGCTTTTAAGGATGCCAGCGCGCCGTAGGATGTAGACGGCCACAGCAACGCACGTGATGGCGACGACAGTTGCTAGTGC
AGTCGCTCCGATTGTTATGTACACATCTGTCGCTGCCAGATCGTAGAGCGAGGAGCTGGACCCGGACGAAGTCGCTGAGTCCACGTCAGCCGGTGACTCG
GAGGTCGGATCGTTGCTATCCACGCGAGCGGCAGCCATCGTTTGGATAGTGTCTACACAGGCCAGGAACTCGCCCTGTGTCGTCCACCATTTGAGCGTGC
ACAGCGTTTTCGCGTGGCAGACTGCGTCTTTGCAGGGTCGAGCATTGGGCGAATGGGCCTTCATATTCCAGTAGTAATCTTCCACCAAGGTCGCGTTCTG
CTCAACGCGCTGCACAAAGGCCGCGAGCTCGGACTTAGATAGTGACTTGAGGCCGTAGGCCTCACTCGCTCGGAACAGAAGCTTCCAGTCAAGCTGCGGG
TCGCTCTCGGCGATAGAAGAGGCATACACAGCGTAGTCGAGCACGTCGTACGTCTCGGTGTCGTAGTCCCAGACCATGAAGGACGGGTTGTTGCCGAAGA
GCGGCGAGATGGAGCCCGTAATATACATAGGCAGCAGCTGGAAAGCATCATCCTCACCGTCGAGTGACCCCACAGGCACGCGGAACTCGATACTGTGGAC
ATGGCCGAAAAACTGCGCCTTGATTACGTCGGCATACTTGCCAACGATTTTCTTGTACGCCGCGATGTACTTGACGTGCCACTGCGGGTTGCCTCCGTAC
GAGTCCACAATCGGAGCGATGTGGCCAGCAATGTATGCAAACTTCCCAGCGTCCTGCAGCTCAGCAAGGGTCGTATCTAGCCACTCAAACTGTCCAAACG
GGTCTGGCTGGTCCGAAGTGTCCGGCAAATGACTCGGCTGCACAGCAACAAAACCCATCAGTCCCAGCCCAATCTCCAAACTTGCAGAAACCTACCGAGT
AGGGCACTGTGTTCAATGTGACCACGTGCAGCTTGTCATCCAGTGGGTAGCTCAAATATCCTCGTCGGTTTAGCAGGTCCATGTTCGCAGCCGAGAGCGA
GTCCTCCCACACGCCCGAGATGATCTCAATGGATGGGTTTGTCTCCTTCTCCGGGTCCGTCACCTCCATGTGATAGTCTGGGTCTGCACCCGCATCAAAT
CACAACAATAAGGATCTCTCCACAAAAATACCAACAAGAGTCTCCTTACTCGCGTCTGCATTGCCAATGATGGCCGTGGCCTCGAGTCGCCCGTCCTGAT
TCTTTGGCGGGAAATAATTCTCCATAACGTGGACGTTAGTCTCCACTGCTTTCGTAATGTATTCATCGCTGAACAGCCCGTGGGCTGCGTGGTCCCCGTG
TACAGGAAGAGATCCGGGTCGTCCACACGTGCATCCTTGGGAAGACCAGCGCAGACTCGACAAGGGCCAGTGGGGCGTCCGCGAAGTAGCGGATGGGGAC
GCGCGCGTTGTCCACCGAGGAAAAAGACGCGGAGATATTGAGGTGCACGTCCGAGAAGTGCAGGATGCGCCCCGCAGACGCCGGCCAGAGCAGCAGCGCC
CAAGCGAGTGACGTCAGCCCCAACATCTCTAAATGTGAGGATCAGAGACTTCCGA