Description :
From Genome Similarity Track
Location :
Scaffold_656:8960- 14746
Transcript NameFunction/comments
Phypl_g10108hypothetical protein PHYSODRAFT_286439
Phypl_g10109hypothetical protein PHYSODRAFT_302462
Phypl_g10110hypothetical protein

Sequence
5786 bases(100 bases per row)
TACCCATTTATAGCGCCCATTTTGATGACGGCTACCCATTACGAGTGAGCAAGCAACGCCTATCGTGCAGGAAAGGCCACACGCCACAGGGCGGTGTCAC
TGGGCTCATTTCGCGGCGCCCTACTGGCAGTAGTACTGCAGCTCATTTACGAAAACGACGGCCGCAGTAGACATGACatcgtcgcgctcgagcgccagcg
ccggctgcacgctctcgctgcagatgcagcagcccaTGACCATCGGGCAGAAGTACCCgggcagcagccgccaccaccactaCTACCCGTCGCAGACGCC
ACGCACGCTGCGCCGACGCTCCTGCCTGCGCAAGGAGAGCGCCTTCACGTGCGGCGGAGCCTCGCGAGGCTCGCGTCTGGACGAACTGTCCGCGACCAAG
ATGGTCACGGTCAGTTACTCGGCCgcgcccaagaagacgctgtcgttCGCCGAtcagcgcggccagcacctcgtgctggagcgcgagtTCTGCCCCAAGG
ACGCGCCCGTGTGCTACTGCGACGTGCCTATCGAGGTCACGGTCGGTCGCCTCACGCgcccacgcagcagcagcttcgacaagtggatcgaggaggccgt
ggcgcgccagcacctgctaTCCGTGTGCGTGGTCTCATTGCTCGGCTGCGCCCTCATCGGCCTCCGCCAGACCGCCAAGTAGGCGGCCCGCGCGcgcaca
gcgccaccatgtACCCGTACTAATTATTATCCGTGCATCGCTTCCTGGACGTGCAGTTTGCATGAGCGACACCAACTTCTTATTGTAATAAACACGTCAA
CAGTAAACACTGCAGTTCCAAACTAGCCGCACATTATTTCCGGCGCTTGGTGGCCCACGTCTTGCCGATCACAGGGAGTTCCAGGCGATGCTTAtccagc
tcgacgcgctgctgcagaatgCTGCTGAGAATCAGTTCGGGGGTGTAGATCCGCTCTGGATTTGCGCTCGCGAGCTGCTTACGCACGGTTGCCACGGCCA
ACGCCGCCTCACTCGTGATCACTAGGTCGTTAGTCCCAGGCTTCCCTTTCGACGACGCCTTGCCGCCCGCACACTCCACAATCTTCACCAGGTCCTTCAC
CGGGGGCAGCACGGACTTGTGGTTGGTAATAAACACGCTGTAGCCAGCGAGcagccgctggcgctgctccgCGGGAACGCCATACATGGTGCTTCTCAGG
TCGAACTGCCACTTGCAttccgcctcctcgtcgtggAGGCAGTTCGCTTGCTCATCAACCGCCGCACCGGCCCGCGCCGACTCGTCCAGCCAGCGTTCAC
CCAGAACAtgcgtgcagcacgagatACCGCACAGCAGTTTCACTGTGCGCTTCAGCTGGCTTTGAGGAGCAATCACAtgcgtggccttctcgatGTTGCT
CTCGTAGACAGCGCCGGCGATCGCCTTGATTTTCTTGCGGATTGCAGTGGTGGGCTCCAGCCCCGTTAGAATGACCCTGACAGATCCATCTTCCGCTTGT
GAGTTCGCTGACTCGCTGTCTGCAAGGGATCGACTGCTTACCGCTCGCTTCCTGCCACGACTCGAGGCAGTCGCCTTGCGCTGGGAACGCGGCGTCACAT
GCGGCGACGTAGAATCCTCAGCAACCAAAGAAGCTTTAACAGGCGGGTTAGTCTCGTCGTTTTGAATGTCGTGAGTCTCTGAACCACTccgatctgctgc
tgagtgcGTCTGCTCACAGTCGTCGGCGCTTTCCTCCGATACGTTCTCTTCCGCCAACGAAGTTGTCTGGTCCAAGCTCGTTGAAGATGTGCTTCCATCT
TCACTATGCCGAGATTGTTTTGCCTTCGCGTAGCTTCCTTTAGGAGATTCACTGTGGTCGCGCTTCAAACTGTGGCGTGGTAATCTTGAACTTTGTGTCT
TTTCTGGTGTCGATAGCGACCGTCGTATGCTCTTCGTgccaggtgctggagaactcTCCTTCTCGGTCACCTTCGAGTAGCTTGCACTCTTGGTAAGACG
CAGTCTCAAGCTGCCCTTAGACGGCGGTTGGGTTTTCTCCTTTGCTGCCCGGTATTTCTCAGGCGATTCCTCCTTCGGTTCGCCTTCAATTTCGGTCTCG
CCACCACTGCTGTCCGATTCATCACGAATTGAaagagctggagatgctcgAAACGGAGTGCGAGGCTTGTAGAGTCTCTTCTTCATAACTTCTGGTTCTG
TCTCTCTCTGCTGGTAAGAAGCAGCGATCGAGGAGAGGCCAGCGACAGAGCCGTCTTGTTCCAGCATGTCGTCCGACATGTCCGAgtcggcatcgtcgtc
actgtTCCCCATTCCAGCGTCGACAACGGGTCGACCAGTTCCGCTTGCTGTCGCCACTATCAGCAGCGGCACTGCTTCCTCAACAATCTTTCGTTCTGGC
TTGGGTGCCCCTAGAATTTAAACCCCCAGCAGTCATTGGTCACCTTCCATCGCTCAGAATCCCAACGCAGTCCCTACCGTCTTGTTCTTCAGAGTTTGTC
ATGCGGatctgcgtctcctcctcatccacctcgtcttcgtcatgaATGTCCTCGTGAGGAGGCGTAGCAGTGACGAACACCGGCGCTAGACCCTCCGCAG
GTTGCGTCGCCACTTCCGTCGCTACCTGCGTCGACTGGCTATCGCGTTGCGTCGGTTCTCCCTCCAGCTGCGACAGCGCGGCGCGCTTGCGGTGGTTGGC
AGTGTACCATTGGCCCGGTGAGTCTCGGAACCCCACGGGGGTCTCCTGCCCAGACGAATCCCCGTCGAAAACGCACGCGGCCTCGCCAGCCATGACGTTT
CCAAGCTCGATTGTTGGTAAATTACCAATGGTAAAGCCGCGGTACAATATCTATTTCGAAGGAGAGTATTGAAAATCTAGATTTGAAGTGGCCAATCACT
GCAGCAGGCTCGCTTCAAGCTCGTCGCGTTGGTCGCTGGAGAGCATGTCGAACTCGTAGACTTtggttttcttcttgtcgccgctcgtgctcgtcttGCT
GGCTGAGATAATGACGGTGTAGCGCTCGGCCATGTCCTTCTTGGACGAAAGCGACCGGAGCAGACCCCTcttggacggcgacggaggaggactGGCCTTC
CCCGTGTCCAGAGCGGAGATTTCGTTGAAGGCAATGTCCGTCGTTTTCGCTGAGCTCGGGGACGAAGGGTTGAGTGGCAGGATGTGGAGGCACCTGTTGG
TCTTGTCGACCACGAGGCGGCTCGATGAGCGAGTTCCCGACCACGAGGTCTGACGATGCAAGAGAAAGTGttagtaaaaaaaaaaagcagCGAGGCAGTT
TGAACCAAAGACAACTCCTATGGATACCATGTTGATCATGAACTGTGTCTGGGATGTGTTCAAGGCAggctccagcttctggtcAGACAACTCGACTTGC
GGTTTCGTGACTTCTACCGTTTGAGTAGGTAGATCTGAAAGTGGCGGCATCTCCAGCTGGGGCGGACGTGCTTGCGATGCCTAGCACAACAAACAGATTT
AGTGTCATCGAGATATCTTGACAACATGCATCCGAGTGCACTTACTTTCACCCGTGAAGGTGAAGCTTCGGGTGAGAGGTCCACATCTGCAAATCGGACT
GTCGATTTTGTAGGCAATGCCTCAACACCGGAGGGTGAAGCAGAGGCATGGTGCGTGGGTGATGTCGAGGCAGCATCGATTGATGAAGACCCCTTCAATA
TTTGTTTTAAGATCGGTGATCTCGGTGGCGGCGTAGTTGAGGGAGCTGGAGCATTCTGGTGATAGTCGGTGTCAAACAGGAGAGTCTTCTCTATCCCAGC
GAGGGATTTGAGAATGCCGATGATGTCTTGGAGTGACAGCGTTTGAACATTAACGCTGTCAATTGCAATGAGGCGACTACCACCTGGAATACCATCAGCC
AGATCGCTTTTGGTTACGCACGCAGCATTTTCGAGCGAGCTATCAAACTCAATCCCCATGGGAGATTTCGAGATGACTACTTGCTTTAGTGCTGGCTTGC
GCGTGGAGCTGAGCATGCTACCGTACGCCTCAGTCGTCGTGCCAAAAGTTATAATCTTTTCATGAGATGCAAACAACCGCATAAGCTGGATCAGGTCTGC
GATATGCAACGAACTGGTATCAAACCCATCGATTGCAAGTATCTCCGATCCGCTCACAACACCACCGTGGTTGAAAATGTAAGTCGGACCGCGCGCGGGG
TTCTCGTTAACGTGATCCACAACCACTCTGCCTTCGACGGTTTTCAGATCGATACCCAACGGACCAGGTGGAACCCGAATACTTACTGTGCGAGGATTGG
ACGTGCCGTCTGCAGTGTGCGTTGAAAACACCAGCTCTTTTGGCGACGAGGCCAGCTTTTGGAGCAAAGTGACTGTTTGGGCTAGGGTCAAACAAACCAC
GCTCATCTTGTTGATGCTCTGCAGTGTCGATCCAACTGGAATGCGACGGCTTTGTTCAATCACTCCTGGTGTTCCATCTACCATGGGATTAAATCCTGAC
ACACGGGCTATATCGTCCCTGTCGCCATCAAATTTGATGCCCAATGGTCCAGGAGGGGCGGTGAAAGCTGCTGTCAACGACCGGGTTTGTTCCAGTTGCC
TCATCAAAGATGCATTTCCAACCACAATCTGCTTCGTTGCATGGCGTAATTTTGAAAGTAGCTTGGAGATACTGTCAAGGGCGTGCCGGTGCACCTCGAG
CCCGTTGATGCCAATGATATAGCTGCCGGATATAAAGTCTTTCAATGGTTTGCACGTCGGGCGATCTGCATCTTCAGGTGTCGTAAAGCCCGTGATTCTA
GCGTGGCCaggctcgctgctgtcgagaTTCAATCCAGACGGTCCCGCATCAATCTGCATTACATGGCATTCCGGCAGGATCACGGCCTCTTGATGGTAAA
AGGTCAGTGTTCTGGGGTATGGCGTTtgatccagcagttccatGGCAGCGACTCGATTCATAGTCGTGACGTCCGTGTCGTTAACGCCAACAAGGACATC
ACCTCCCACGACCTCGTTTTCGGCTGTAGTATTGACCGAAAACACAACACATCGAAAGATCTCAGTCTCGGCAAATGAGACCCCAGTATCCTCAGAAGAA
AGCATGAGTTTCGAGAATCTAGCGCAGGTGGTTGGAGTCATGCGGTACAGAAGGATCTCTTTGTCTTGCTCCCTCATACCTGCCAAAACGTTCGACACCT
CTTCACGTGACAGTCCAGACACGTCTATGCCGTTAATACCGACGAGCTGGCATCCGCGATGAAGATTTTGGTATCTCGTGATGTGGCTTTTGGATCCATC
TGGAAGTTGCTGAAAGCCTTCGATGACGGCACCGTAGTGGAGAACATCGCTGAGAATCAAGCCTAAGGGCCCACTGGGAGCACGTACAAGGACCAGCTTC
TCCGGGTCGTAGCTTTTGACGCTGCGTTGCGCTTGGTGATATCGCGCAAATTTCAAttgccgcttcttcgccgaTAGCTTCCCCAAGCGGGTCGTAACTT
CCGACAAGCTACAGTGAGCAACTTCATCGCCGTCAATTGCCACCAGCCGATCGCCAGCATGAACAATCTCGCGCATGACAGATAGTCGTTGCTTGTCCGA
CTCACTGGAGGCTGCTTGATCAGCGGCCAGTATTTCAGTAAATCCTTGAACGATGACGAAACCACGCTCATTCTCAACCAGCAATACGCCCAACCGACCA
GCGGGAGCTTCAGCGATGAAATGCTCGCGACCGAACTCGTCCACAACCATAGTTGACTATTCCCAAGTAGCGCTCGTTCAGGAATG