Description :
From Genome Similarity Track
Location :
Scaffold_293:896- 32505
Transcript NameFunction/comments
Phyke_g7904transient receptor potential Ca2 channel (TRP-CC) family protein
Phyke_g7905hypothetical protein PHYSODRAFT_566381
Phyke_g7906hypothetical protein PHYSODRAFT_533462
Phyke_g7907hypothetical protein PHYSODRAFT_289190
Phyke_g7908conserved hypothetical protein
Phyke_g7909conserved hypothetical protein
Phyke_g7910conserved hypothetical protein
Phyke_g7911hypothetical protein PHYSODRAFT_307593
Phyke_g7912hypothetical protein
Phyke_g7913DNA ligase, putative
Phyke_g7914hypothetical protein PHYSODRAFT_533247
Phyke_g7915hypothetical protein

Sequence
31609 bases(100 bases per row)
TCATCCAACACTAGCGCGAGGTTGTTGCTTGCCGTTATCACCGTTGCCTGGCCTCGGCTTCTGCAAGAACCggcgagctgcagcttgcgccACTGGACTT
GACAGCAAAGATACGCCTGCATCGCTGCCATGaccatcgtcactgtcgcCATAGCGCAGGTCGTGTAGAAGTTCTCCAAACCCACGCCCATAACCTAGat
cgctggagaagacgtaACCCCGACCCTCTCGCTCAAACAACCTGCCCAATGCTGAATCCACACCTCGGGGCCTCTTAGAAAAATAAATAGGTACAATCGT
TTTGCCTTTGTCCTCAGCGAATGCCAGTTGATCGCTCACCAGCTCCGTTTTCACACTGCGCTCTGATAGAACAACCAAAAACACCGAGCTCTGCAAAATT
GCATCCTTAGCTGCCAAAATGCGCTCCTTGGTACTGGATACGTTGGTCATCGAATCAACAACGAAAGggagctggtggcgacgcAACTCCGTGCATAGGC
GCGTAACAAAGTCGCGATGACAGTCCCCGTGTGAAACAAAGATCGAGAACGCAGGTCCAGCAAATGTACTTCGCCTTCCACTACCGCGTACAACCACAGC
ATTAACAACTTCATCCATTCGGCGCCGCCTCATTGTTGCAGACCTCACCAACGGATGGCCACCAGCTACATGTATGCTTGCAGGTCCCTGTCCAAGGTCT
CGATCACCTCCTAATCGATGCATTTCCACTTCGTCTCGTAAACCATCAATAAGACTCCTGAGACTCGCTTGAAACTTATCTTCATTAATTTCGAACTCCA
CGTGATCCACAGCTGATGAGTCCGATGCAGTTGAACTATCGTCGCCAGAATCCGTCGCCTTCGTGTGAGCTGGCGTTACTGCATGACCGAAAGGCACAAT
CTGCCGCGTGAAAATGAACACTTGCAACTCTTCAGACATTTTGGTCGACTCGCACGAAATCGGCACAACTGggacttcgtgctgcttggcaaAAGCAAGC
TCGTCCATGCACAGCGCACTCTGCGCGTACCCATCACTGAGCACACAGACAAGGGCAGAAGCATTTTTCATTACCTTCAGTGACTCTTCAGATGCACCAT
CTCCCTCttttccagctgcatcttcattttcagtGCGCATGTACACCGTCATGAAGTTCTGCTCAATACCGATGCGCACCCGCTCGGCAAACGCACGATA
CGTTGGGTCGAACGAAAGCACAACGTCTACACAATCACCTGCGACTTTGACTGCATACTGAAGCTCGGCTGATGCGCAGCACTCTATAGCGCGACGATCC
TCCCCATTCAGCGCGTAAAGGTCGGCTTTACCCTCGACCAGCAGCGCTAGCGCAGCTTCGCTGCATCCAAGCCGCAGCGCAATGTGCAAAGGCGTCTCAT
CAAGATCGTTGGGGACATTCGCACTGATATCTGTTCCAAAACGAACAAAGAGTTCCACGCAATCTGCTCGCAATAATCCACCATCCGCAGCAAATGCCAG
CGGTGTCATTCCATCGTGGTCCAGCTGTAATGGGTCCGCATCTAAAGCGAGTAGTTCCTCCACCGCCTCGGCATAGTTGTGACGTGCGGCCCAGTGAAGT
GGGGTACGCCCATGACTGTCCTTAGTGTTGACATCGGCGCCGTGCTTTACGAGTTCGCTAATCACGCGCTTCCTTCCCATTACAGCTGCCCAGTGCAACG
GGGTACGTCTGTGCACACCGCGTTGAAATTCGCCGAGTACGTCCGCGCTAATTCCCCAGGAGAGTGACTGCTGCACAGAGGCGAGATTTCcagccgcagc
agcctcatGGAGTGGTGTGAGGGCCACGTCAGCGCCCCATTCCTCTAGTACGGAAGCCAGCTCGCGTCGGCCATTGAGCTGCGCGCGCTGAAGTACTGTT
GTGCTGGCGGCGTTGCCACTTCCTGGCACTAGAAGAATATTTGCTCGGTGTCTGATTAGactctccaccacttcggCTGAGTCCGCAAGAAAAACTGGCG
TGACTCGCATGGAACGCGAGAAGAAGCTTGATCGAGCTAAACTGTCCAAATTGGCACCAAATTGCACTAACAAGTCGATGACTGCGGTGTGGCCGTGTAA
TGCTGCCACGTGCAGCGGTGCACCTAAAATATGAGTCACTTTCTTCACTCTCAATTGACAGAGTTCGTACAGCAGTTCCAGATTGAAGGTTGCACCCGAG
ATTTTATCGAGGAAATTCGGGTTCAGACCCGCTTTAAGCAGCACCGACACGACACGCACGTCTCCAAAGCGACACGCCACATGAAGTGGGTTGTGTGTTC
GATGCGAGAACATCCAGGCAACGAGGGCGGGTGTAGTGTACATGCGATTGAGCAGCATGTCTAGCTGCACCTTGGATCCAAGCACATGTTGTGCTCGCTC
CAATAATTTCTCCACCGCCGCACAGTTcccacttgctgctgcatcatacAGTGCACCGCGCAACTGTTTCTCCACCGTTCGAGCGGTACTTTGAGGAGTC
GTCGACGGATGAAGTTCTCGGTTCAAAGTCAGGTAGGAATCCACGTTATTCGCTTGCAATATCGGGGTATTAACTCCACTTGGAGCAGAATTCCtatcac
caccagaatcaGTCTCAGACTCAGACGAAGTATTTTCCCCAGCGAGTGCCATAGGAGCGAGTGCCATGAGctcatcttcctccagtcctgcaccaagctg
cagctgctgatgtGCCCGGAGTCGATCGAACTGTTGCGTGTGCAGTGCAATACTGAGAATAGCCAATAGCGTAACGTACGACGTAGAATCTGTCCAGATC
TCCCACACTCCTTCCTCCGTGAGGTCTCCAAACGCCCAATACACCgccagcatcagcaccacgaTCCACGAGAGGGAGATGGTCTGGATCACCACAATAG
CTTCAAACAGAGCGAGCGTTAGGGTACGTTCTAGCGTAACCCCAGCGCCATCGAAGGCGGAGCGagagagcgaggaggaaCTCACTACGTGTAACCCAAG
CAGCTGTTCGCTGGTCGTAGCAGTGGATTCGTCATTCTGATCACCACTCTTGGATGTTACATTCACTCTGTAGAGACGCACAAACGGCAGTGCTGAGAAC
CCCAGCGACACGTTGAGAGTTTGTAGACCAAGCCAAAGATCCAGTACAAAACCTTTGTCACTGTACAATAGTAGCAGCACCATGGAGCCCATAGAGAGGA
GAGAAGTGAGTGCTACACGCCACATGTAGTACGAGTTAGACCACTGCAAGTAGGCGTCCGCACcgcgccagcagcagcagcgagaagcCGACGACAAAGC
AGGAGCGGCAGCGTCATCTGCGGCTGCGATTGCCATTTCTCTGATGTTTCCTTTCACCCTTTGTGCAGTAACatgatgtggaccacataaTATATAAATA
TGTTGTGATTGGCTAATATCGAAGAAAGTGGTACTGTTCGCTGCAAGCAGGAACTTGGTCGGACGATTGTGATAAAGCAATTCAAGCACCAAAGCTATAC
ACGTCAGACCTTGTTGGAGCAGTACTGCAACAACTCATAGTACAGAAGTCCTTAGGTGGTGAGAATTCTCGTGCGAACGACAAAATTCTCCATGCAATAA
ATGTTGAAAAATGGCACCAATCATTCGTCGACAAAAATGTCACTAGACGATAGCGGGTAGGGGTATAAGACGTGGCCGCGTCTACATCCAAGTAGCAAAT
AATTTCCGCAACACAGCATTTTTGTAAAGTAGCTAAGCTCTGCAGACACTTTCTGCATACAAAGTGATCGGTCAACCAATCAACTAACTGAACGCCCAAC
AGAAGGAAGTCGACCGAAGGAAGAAGGCAACAACGTGGACGCCGCACGCGCAGCTCTCTCTTAGCCTCAGGACGCAACTACAGGCACCAACACTAAAACA
GCAGACGCAGGACATCCCCATCTACAAGAACAGCTTTTCACAACTCTCCCCCGACATCTAGAACGGCATAAAATAGACGGGAAAGGCATGGCAAAGCGTA
TCCGCGTGACCAAACAGGAAACCAATGGCATTTCGGCAGCTCCCGCAGCCCCCAGCGCCCCAGAAGCAGCTaagatgacagcagcagcgaccgGCGCAGC
CTCCAAGGCCAAGGCCACGACCTCCACGACCGCAGAGGGAAAACACGTGATGTTACCGGCCTTCCTTTCCAAGACGTTCGAGATTTTTAGTATGCCAGAG
TTCTCCTCCATTTGTGGCTGGAACGCCAACGGAGACACGATCATCGTGTCACAGCTGGAGACCTTTGTGTCGATGGTGCTCCCGCGCTTCTTTAAGCACC
GAAATTTCCCGTCGTTTGTACGACAGTTGAACCTCTACGGCTTCCACAAGACGGTACTGGACTCGAAGCGCTTGGAGTTCCAGCACCCGTACTTTAAGAG
AGGAAGACCGGACCTTCTCCACCATATCAAACGAAAGGTCTCATCCAATaatcaccagcagcagcagctcgtcagcACTTCGATTCAGGTGGGAATGATT
GTTGAAAAAATGGGAGATTTGATACGTATGCTGATTATTTGTACTTTTGTTTGCTACAGAACTCGCGACTGGATGCCCACCGTGAGATTTCGGACACGTT
GCTTCgcgagatgaaggagctgcgtcaGCGGAGTGATGCGATGGAGAAACGTCTGCGTGAAGTGGAGATTGACAACGCGGTATAGACACAAGTACTTTTT
TGTCAAGAAGTGATGGGAAGATTCAttgcttttgttttgtgttgcTATGTTAGATTGTACGAAGTGACAATTTGAAGTTGTGGAAACATCTCGAGTCAGC
GAAGGACAAGCAGTTAGTAATGCaggagaaaatgaagaagatcatgtGGATTCTGTTCCAAATCTACCGtggaaagcagcagaaactccCCAAATTGTCC
AGCAATGACGCTACTGGTGCTGTGATCAGCGAAGAGTAAGTGTCGTATCTCTATATGGTGTGGATACCAGCgcttcttggttcttgacAAGGGAGTAATT
CGACATGTGACTAACcaattttgctgctgtgtgaTATCTGCTATTCGTGTCTGCTCCTCGTTGGATATGAACTTGTTGTTGACCTATTGGTAGCTACGTC
AACAGCAGTATGCTCGGACCGAAGGAATTTCATGACGTCTTGCGCTTTTTAGCAATGGATGAACCGCCAATGCTGCCCGGATCGTCCTCCAACAATGCGG
CTGCCCAGGCTCCGACTTCTCGGAAGAGGAAATTCGTCGAGGTGCCGGCTGATGCTGGTGACATGTTCACCACCGAGGCAATCCCGTATAAAATAGGTAT
GTTTTGCATCCGCCTTTGCTTGATAGGCACTTTCGGTATCAACTAATTTTGTTTTGATATTAGATGATGAGCCATCTGCTGTGGTCGAAATGCCCACGAC
GGTGGAGGATCCCAATCAGTTTGCAATGACAGTACCATCCAACCCGCCCCCTATGGTGCGTCCCGACGATACCCAGAACAATATTCTGAGTATTTTTTCG
CCGATCAAAAGTGGTCAGGCTACAGTGCCAAACGCCAACTTACCCAGCATGGAGTCTGCTACACTGGGCGGATTTCTCACGAACGGTGTAGCCTCACCTC
CGAATACTGAGATTGATGAAAACATAACGGGGGTGAACGCGTCAAATGGCACTGCAACTGTACCTGGTACGGCGCCAGAATCAAGCAACCAGCTAGCATT
TTTGGACGAGGATCTTCCTTTGCTACCGGACTCTGAACACTACAATTTCAACGAAGGCGAGCAGGTACTTGTAAAGCATCCTTTGGATTTTGTTTTGGTT
ACACCTTGACCGGAACAGTGGTTTAATGGGATGTCTCTTGCTGGGGCGCCTATTAGCAGActgtgatgaagaagctcgaggaTTTTGAGACGTCATTGTT
GGACGAGTACGATGTAAGCTGCCTTGACACACTGCTGCAGGTACGTTGCTAGTTGTTTGGACCAATACATCATATTTCAATTGGCTAATGCTTTGCGATG
TGTTCGTGGCAAACAGCAACTGAAAAACTCGAGTGGAGATAAAACTGCGAATGTTTCAGTGCCAGACCCGGAGGAGATGGTTGTTGGTTCAAGCAACGCG
TCCCCACACAGCGCGTAACCTGTAGGTGGCGTGGACTGAAGCCAGCTACCACCTCGATACTGTCGTGTGCTGGGCGCTGGCAACCCCCAAGAAAAAGTAT
ATATCTACGTACATGTCAAGTGAGGCGCCGCGCGCGCGTTATCACCGATACGAGTGAAGGATACCGTCGGATGATTGACAAGCATCGCGTAGCCTCGTGT
CTCCAGGTATAGAAACAGATCGAGTGTCAAGTCAAGATCATGCGAGGTGAGTTGGACAGAAAAGCATCCAGGCCGCCGAGAAATAAAAGGAGACGGAGAA
GTTCGTACAAACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCCCCGGAACGATGACGAGCACATACACAGGCTGTTTTTA
TTTATCAAAGGTGAGAACATCAAATAAATGAAACAGAAAGAAGTATCCTCTGCATTGTACACGTTATTACATGGTGCTTACTTAGCATCAACAACCCTAC
TGCAGCGTATTCCCTATTGACGACCATCCAGAATTTTACGCAGTCGTTGGATCTCCTTATCCTTGCGGCTGAGCTCGAGTTGTGCTGTCGCAAACAGCGT
CGAGATATTTGTCTCCAGTTGCTTGTTGGCTGCTCCCAAGAGCCgattctgttgctgcaattgtGCCAGCTCGTCTCTTAATCGTGCATTTTCCTTCTCA
GCTTGAGTCTTGAGGTCCAgcgcctccttcttctccaacgcACTGGTGGAGGTGTCCAAGTCCCCGTACAGATCGTCCATTTTTTTCAAATCTGCATACA
AAACACAAGTGAACGTCGGAATGAATTGGAACCAGTCACTAGACACGCCACGATGGACGCACGATGCATCAAGTTTTGGGAGGATGGCCAGGCGCTGGTG
GCTGCCACGTCGGACAGCTCGCGGATTGAGCAGACACAAGGCAAGATCTTCAAGGAATTACGCACCATGAGTCGGCTCCTGCAACGCAACCAAAGCCAGC
GCTTCAGtgatgcagcacagcagaaACTCGTGGACTGTGTGGGACACTATGTGGGGCTGGGCAAACAGACAGGTGTCATGCTTCCTGTGGCTGAGGCGAC
GTTCcaggtggtgaaggatgGGCTGGCCATGCCTTTCAACGTGGTCGGCACTAAACAGAAGAAGCGGCTCCTCAAATGGTACAATGAGCTCATTACCATC
GTAGGCGGAGACCAAGAAACTCTGGCTGAGAACGGAGAGGCCCAAGTAGTCTCGAACATTGAGTGGAGTGTCATGGAcatcgacgaagacggtTATCTGT
CACTTATGCAGCCAGAAACTGGAGACACAAACGAGAGTTTTCAagtcaagaagaaaagcgcAGAGTTCAAACGCATCAAGAAAGCATTCGAGGAACAAGA
GGTCACTGTCGTTACCAGTGGGGACGATATTGTAGATATCCGAGTCGAGGACCAGTAGACGGCAGCTTCCTACATGCTAAAAGATAATTAAGGGGGCAGC
CACAATGCCAATTTGCAACTTGGCTCCACCAGGAAGATGTCTAAAAAGGAGCTGCGGTGGCTCCGTTCTTGTCACGACTCTCAGTCCACGCCTTGGCGAT
CGTACGCTTCATCTCATCGTCTCCTCGATCGTACATGTCCTACATAGGGATACACCTGGTTAGCTTCATTTGCTTTCTCACAGCAACAATGTCAGACCCC
AGGCATACCTTCATCATGCCCATGATTCCTGCGGTCGGGTCGGCCGAGTCAGGTTTGCTGCTTCCCTTAGTAGGGTTCTTGGCTGTTAGATTCATCCACG
TGTTGTCCTTATCTGCCTTAATCAGGGAGATCGTCACTcggttcttcttcactcgaAACGAGCTCCTTTTTGGGtcaatctccttctccaagttCTGCTT
GATCAGTCTGGGAAAAAAGTTTTGTCAGCTTACCATCTTTTTCTCTATAGTCACCTTCAAAACTCACCGGTAGTTCTTGTTTCCTAGTCCAATAATCTTC
AGATCGAACGACGTCTTGGTGAATTGACACACCACGTTCTCCTTGGGCAACGCGCCGACGCCATCAATGCCCGACATGATATAGACCGCCACTTTCTCCT
TGCCGTAGCCGTCGTCCTCCCAACCGAAGCGAGAGATCTCCGTAAACGTCTTAAAATCATCCACAGCGGACGGAGCTACGACCTTCTGTACGGGCGCTGG
CGGGGACGTCTCCACCGTCAAAGGCTCCTGCTGTTGgggtgcagcagcctccatATCCTTTTGCTTGCGCTGCAAGAGCTGCTCCAAGTCACGACGATTG
CCTGGCGTTTTAATCTGCGTTAGaagcgtctgcagctccgtcacCTCCGCTGTCAATTGTTCGTAACCTGTCATAACGTTACTATGGAATCTTTAAATGG
AAAATGACACGAAAAAATAGCTGGAAAAATAAGTTAAGGAACTTTCTAGAAGGGTGGAATAAAATTTGATTGGATAATTCtgattttgaccaatcataaT
TACGAAGAAATGTCTATGAGCCACTAGCTGAGATCCTACTGCGTGAACACCATAAAGAACCTGTTCAGCTACTACTTGAAACTGAAGGCCTCTAGGAGAT
CATTGCCGTACACACTTGCTTTGCTAACGCTAACGTTACTATATATCGTCCATGCTAACCTGAAAGATCCGCTTCATCTTGTCCGATTTTCAGATTTGAT
GTGGACCACTTCACCTAGTCGCAGTACTATTTCGCACAATTCAGAGTTTATTCTGGCGCGCGAAACGATGGACGGAAGGGCTCCCGTCTCGGGTGGCTGG
GCGGCGTCGAAGACCATAGTGCCGATCTCCCCACCTGATATGAACACGATGACGCTCTCCACTTCGCCTCCTGACTTTGATGAGTGTTCTTCGCCTCCTA
TAGCCCCCACAAATCgcacagcatcgtcgtctcgCTCCCCAGTACACACTTCAACAGGAACTGCAGTTAATGTGACTTCAGCCGCATCTTCAGGCGCCAA
TGTAGCAGTAAATGGATCAACACAGATACATGAGGCAGTAGATGCTTCTAATACACCAGAGATATCGACATCAGCGTTGCCACAGACTTCCGGAGGCGAT
AAAAACCCAACGATTAGCGAGAAAGGACAACTAGCTGTTGCAGGGACTACTACCAATGGACAACAGAATGGAGGGCCTGGTACTAATGCATCAGGTTTAT
ACAGGAAGAGTGGTCGAGAGAATGCTGCTTCAGGGCAGAGTGCGGTGagtggtgatggtgctgtaCAAATGAATCCTCAACCTGGCGCTAAAGGGGGGAA
AATGAAGTGGTTCGAGATCAtgccggtggtgctgcagaatttTATTGATCGTGACCAAGAACAGATTAGACGTACGTGATGGGGATAATGTTTTTATTGA
TAAGGTTGGTGGTAGGAACTAAATGCTGATActgtgtttgttgttgtggtgaACTTACAGAGCTGGCGCTGCCACGTTGTAGAGAATGCGAACGAAGTGG
TAAAATTCAAAAAGCAGATGCTAAGTGCTCTGAAAAGGGCTGTGCACTTGCTGGGCAGCCATTGTGTTCATCTTGCTGGGAAAATAGACATTCCTCTGAC
GAAGAACGAATACACCAAAAGGTTAATCCCTCAAGTAAGTATTCTCAATGTTTAAATGCAGATGTGGAAGTGGTTGTTTCTTACAATGTTGTATGTATGC
AGATTGCCCACAGTGCCAATTAAAGCATTCAGCATTTTGGTGTTCAGAATGCGACTTGAGTTTCTGTCGTGAGTGTTTCGATCAGATTCATAGTGTGCCC
AGAGTAAAAGGCCACCGCAAACTCGCGATGGAAGGTGCGTATATGTATCGcttatttttttcttgggaGAATAAAACTGATCGTGTGCTCTGCATTTGTG
CATGCTTAGATTCTCCAGGAAGCTATATAGCTAAAGCGAATTGGTCCATGAATTTCCAGAGTGCAATTATGCAAATGATAGCCATGCGAAAACAAAAACT
TGGTGTTTCGTCTCAAAAGAATAACGCCGCGGGATATAGCGTCGGCGAAAAGCGGAAACGCGATGTGGAAGTGATTACTATcgatgacagtgatgacgac
gagggAAAAGCAGATAATATTGCTGTGGAAATCACACCCTCTCTTGGCAACGGAGTATACAGATTTGGTGGACACAACGTGTCTTCGTCGATTCAACAAG
GTCAAGCTACTGCAGGGAGGAAGGAAGTTGTTTCCCAAGTGCAGGCGATTATGCAAACGAACCCTGCAAGCATGAACTTCCAGCCCCCAGTTTCTCAGGT
CCCGACAATGTCCATACCAGTACCTGAACCCATCCCGTTTCCCCAAGATCTCTCAGGAACTGTTTCGTCCACGATATCAACGCCATCTGTTGCTTTCGAA
CCTCCTGTTTCATCTGTGCAAATATCTGCGCTGTACAATGCGTTGACACAGCCGAACACTAGCAGCAACGTGAACACCACCACTAGCGTTGGGTTCTCCC
AGTGGAATTCTAGTCTGCCCCAGTCCGGGGCAACATCGATGGATACAGTAACTTCCAGCGGTAGCACGACCTACACGTCAATTGGAATGAATAATGGCGC
TATGGGAACGTACTCAGCCCCGATGGACGTGTCAAGCGGGATGTGGGATACAAATTCTGCCGTAAGCACTGATTTGGCCAACAGGTCGAGTTCCTTTATA
TCGTTGGCGAGCTCCGTGTTTGCGGAGAACCCGTTGGTTGACTCGTTATTGGACCGCTACAATGAAGCGAACCAGAGAGTGCTGCACTTGGAACTGCAGA
GTGAGCAGTTAGGCAAACAGATTACGGTCGCCACGTATAAGGGATTATATGCTGCGAGCCCCTTCATGACCAAGCTAAACGAGCTGAAGCCTTTACTGGA
AGCTGCGAAAGTTCAGCGCGACAAGTTGCTAATTATCATGGTTATCCAGTCAAACGACATCATGGGTGCGGTCCGTCGTCTGCGTTTGAGCGAGCTCTTT
GATGTGCCGCAAGTGCCAATTGTGAGCCACCGCAAAGTACTGCAGTTATCGATTCAGATCAATaagcagaagaaggcaacgATGGAATTGAACAGGCAGA
TGTCGATGACACTTAATGAACCTCAAGTAGGAAACGCGAGCTCCCTAACGACGAGAATCCGTGCGATCAGTCTTAATATCCAGACGCTTGAGGAAAACAT
TaagaaactgaagaaggaCCGCGAATCGGAGATTGTTCGCATTATACAGTTCAGTGATAAAATCCGCGAGGCACTCAAGCAGGAGTTCCACCGGAATGTG
GAAATGcagcgtcaacagcagcggcaagCCCAGTCGTTTCGATAGAGCAATTTGTGATAGACCGAAATGACCTTCGATACGTCACCAGCGTTTACGATCC
TGGGAAACGACTTCAAGCGCTAGATGGAACAGGATGTGTAGATGGTGGAGGTAACACAAGCTGATTATTTAATGGAGAAATGAGAACAAGCAGTCGTGTC
AACCGTGCCGAAACACGAGGAAGCCGATCTGGCCCAAGAAAAAATATagcattctgcagcagcacagcttCAGTAAGGTACGTTATACtaagatggagaa
gcagacTTACTTTTTGACCTCGTGTGAGACAAAGGAGCCGAAGGACTTGCCCACGATGACATGCCACGCGCCTTCTTGGCTCTCCTCAATTTCGTGCTTC
ACCTGCTGTGCGACCTCGGTGAAGTGCGTCTTTTCGCCCTTGTAGAGCGCTTTGAGAGCGTTGGTGGCGCTAGTAAGgatcagctcttccagctccttgg
aTGTGTCCTGGTACACGATGCGCAGTCCGCCCACGGATACATCGTCTTTCTTTTGCGCCTTGGACATGCTGATGATCTGCGCTACGGATGCTATTGCTGG
TATGAAGCCGATCTTTTCGATGGGCGTCCGTTGGTAGTGTGCAAAACTGTCAATGGTGCGTCGGACTCGCAGGGTGCTATATCGAGTGTGGCGTTTGTTG
CAGACACCGTGCAAATTGCGAGGGTCATGCCAAACAACCGAGACGTCTTCGAGACGCTAGTGAAGCGAACAGTGCACAATGTTCTATTTGTCAAACCTTC
AAGACAATCCAGTAGTGCAGACCACAGGCCTGGTGTGCTTCCTGCCACTTCAACAAGCTTTACCAATCAAGTTGCTGTCACGAATGAACGCGCAATTTCA
ATTCTGGATCTAGgttctcttcttcattcaCTGCTGAGCGACAACAATACTAAAGTAGATGGTTCCGCTCAAGACGATGAGGCAAACAGCGAACAGCATG
CGTGGGCCCTGGAATGTCTGAATTGGCCAATACGACGCTTACGAGATGAGAAAGCTATCATCAAGAGATATCTTCAGAAACAACACAGCAACCAGCCACA
GCACACATCCAAGGTGTGCACCGAGCTTTTTGCCGTCCACGAGGTGTATGCACTTctcaagctcctcctcatTGAAAGAGACCCCGTCTATCGCCAGCAC
GTGCTggcttccagcaccagtaGCAGCGAGTTCCTAACATCATTGCACGCGCTCCTAACACTGTACGCAACACACTTCGAACACATCCACGGCAGACAGG
TATCCATCATGGCTTCTCTATGAATGCACAAATGTATTTTGAGGCCTTATATGTGCACATCCATGCTGTAGATCTCCGAGGAAGGTGACGTGAAACCCAT
CCAGACACTCTACAACTTGTTCCTCGCTCAAAATTGCGTTTCCGACAGCAGTTAACGTCGAAAGCTCAAAAAACCAATCCCCGCAGTCTTCACACGTACG
GGCTGTACGTGGGGATGATATCATCCTTCTTCGAGTCCAAGCACGGCACCGACAGCCAAGTGAAGTAGAAAGCAGCTCCACCCAACACGTGCATACAACC
TTTAGCGAGTCCCAGAGCAGTATGGTTatctccgtcttctccttcaaagAAAATGGGGATCCCAcccacaacagcagcagcagccagacAACTCAACGCA
TACTTGGCCTTCTCCTTATTTAGAGGAGAAATGTTCCGGTCTTGAGATAGCAGGCGACGGTACGCGACGCCCGCGAGGTAGCTGACTACCAGAAGTCCTT
CGTACAGTGTTGAGTCCCATCCGTCCTTGGTCTTGAACAGCCACGCGCCCGCAAATGCCACATATCGTAGCACTATATTGTGATTTTCGTCCCGATATCC
CATTAAGTGTACACACAAAAGTAGGAAATAGGTGATACTCAAAACGTCCGAAATAAAGTGCCATTCCGTCTCTTTGAGGAAAAATTGGGTACCAAACGCT
TCCACGGCGTTGAAGCAGAACGAGaccaccagctgcaacacGCCCACGAACAACTCGAAGTGACGACGATTGCGCTTCATCACGTCCAGCGCAGGCAGCA
TGGCCACATCTGTgagcgccaagaaggcgaagcgGCCGAGCGCTAGCAGCATGATCTTGTGGTGTGCTGACTCGTGCCTATTTGAAGCATGAGCCAATCA
TTGGTTTTATTTATCTTTTCAGCGAATGATATTAACATATGTCAAATACAAGACCCTCGTTTAAAATGATACCGTATTTAAAAGGGATTTGAAGTTGAAT
GCACGCAAATCTCCCCAGTCGAATTTACATtcacttcgcaatttgcGCAACAccaaagaggagaagaatAAGATTTTGACCTATTTGTAGACGAATGGCA
GGAGCTACCAACACAAACTCGGGCTCGGCACTTCGTCTGGACGGCAAAGTTACTAGCGATGTCATTCGTGAGCAGCAATTGGCTCCGCAATGTGCAGAAT
TTCTCATTCGTCACGGTCGTCGTGTGGGGTTGGCTGTTGTGATCGTGGGTTCCCGTCAAGACTCTGCCACATACGTGAGGATGAAACAGAAGGCCTGTAG
AGCTGCAGGTATTGAGTCTTGGAAGATCCAGATCCAAGTAAATGAAGACAAAGATAACAAGAAAGTGACCCAAGAGCTGTTGCAGACCATCCAGGACCTC
AACAACCGAGACGATGTCGACGGTATCATCGTACAGCTCCCTCTGCCTTCTTTCTGTGACGAAGACGCTATTCTAGCGACCATTGATCCGAACAAGGACG
TCGATGGACTGCACCCATCGAACCATGCTGCCCTCTTCCAATTTGCTAGTAAaaaagcttcttcagcgcatGAAGAGGCGCGATTCAGTCTGCCCTGTAC
ACCTGCAGGATGTCTGGAGTTGTTGGACCATTATGACATCCCGTTAGAGGGTAAAcacgtggtggtgctaggTCGCAGCCAAATTGTTGGTCTGCCGGTG
TCGTTGCTCTGTTTGCGTCGCAACGCCACAGTCACAATGTGCCATTCGCGTACTCAGGACCTCAAGGCGCGTGTGCTTGAGGCTGATATCgtcattgctg
ccatcggGCGTGCACGGTTTGTGCAAGGAGATTGGATTAAGCCTGGCGCAACGGTGATCGATGTCGGTATCAACCCCGTGGAGGATGCTTCGAAGAAGAG
CGGATACCGACTTGTAGGAGACGTGGATTTCGACGAGGCTGCCAAGGTGGCGCATGCTATCACCCCCGTCCCTGGTGGCATTGGACCGATGACTGTAGCG
ATGCTACTCAAGAACACTATTCAGTGTGCGTTGCGATGTGTGCAACGACAACAGTGAATGAAGTGATATGAAAGCGTCAATAAAACGCTGGCCCTCTATT
CTGGTGCTTGGAGAATCACCCTGGCTCACCATGGACACGAATTGTCCGTGCTTAGCTTTGGCTGCTTGTCTAGTTAGTAAGGCGACACTCATCAATATAG
CGTTCCCTTCATCCCGGATCTACTTTGCTACAAATGGAAGCGTTAAAAGGTTGGGGTatcgtcgtccgagtcgtGACCAAAAAGCAAATCAGCCTCGTCT
TCAGACGAAAATTGGCCGCTTTCTTCTACGAGCTGCACGTCTTGGTGTAATTCTTCCCAATACCCGCCTCGTGATTGCTCAGCATTGGCAGACCCCTGAC
CACTGCTTCGTTCGTCGATGTTTGCAGCATCTGGGTCGGTGTCTTCTGTTGAAGCGCGATatgattgagcagcagcttgcttcTGGTGCACGTGATTtac
agcttcttccagtcTTTCAAAAACCGTTTTTTCACTAGGTAGACGGGTAGGTGGCCGTTGCTGTTCTGTTGGCTCAGCTTTTGATGCAGCTTCATATCTC
CGCTGTGCCTGAAGGAGTACTCGCATGCCGTCAAGCTGACCatacgctgcagcaatctGTGCGGGGGACTCCCAATCGCTATTGACAAGCGTAGGATCAG
CTCCGAGTGACAACAAATGCTGCATAACTGCTGTACGGCCCGAAAACGCAGCCCAGTGTAGTGGAGTGTCGCCTCTTTCGTCAGCCACATTCAAGTCTGC
TCCATGTTGAGCCAGCCTAGATATGATTGGTAGTGCAGCAGGAGATTCCACTGCGAAGTGCAATGGTGCACGTCGGAGTTCATCAATGGCGTTTACATCC
GCTCCTCCTCCAGGTATTAACAAGAACGTCGCCATGCCTGCGTCGTGCGTCAAAACTGCAAGGTGGAGTGCCGTTCGACCTTGTGAATCACCTTGCGCCT
GGAGCATGCAGTTCCATTCAGTATTCACTGTAGTGGGCACCAATATCTGCTTCGCGCACTCTACAAACCCTTGTTCCACAAGAATATGCAGCGGGTACCG
CCCCGTGCTGTCCGGTGTATGCAGAGAAAATCCCGACGGAAGCGCCACGATAGTTTCGGTGGCAACAGCATTTCCAATGACAGTGCTTTTCGTCATCATC
AGTTGTTGTAGGAAGCCGCAGATCTCGACTTGGTCCTTCTCACAAGCACAATGCAGTACGTTTTGGCCCTTGCTGTTGGTCATCTGGATATCAGCCCCgt
gcttgagcagcttctgcatgaACTCAAAATGCCCAAGCGACGCGTATAGCATTAATGGCGTGTCACCATTGCAATCAACTGCATTTACGTCCAAGTTCGT
CTCAGAACGAAGCAAGAATTCCAACATTTCCGCCCGATACCGATATGTTTCGGTGGAGAAAGCCAGCATATGTAACACATTGCGCTGCGTCTTAGCCTCA
ACAGCTCCCAGATCGGCACCTCGTTGCTGAAGGAAGATGGCTTCTTCTACTGACGCATTTTCTACAGCATCAAAAATCGTGACTTCCCATTTCGCTCGTT
GAGACAGCAAGGGAGACGATGGTGCAAATGACAAAGGAGAGGATGGCGCAGACAGCACGGGTGAGACCATCACGACTTGCGTATCTACCTCCAAGAGCTG
TTCTCGCCGAATTTGAGCGCGTCGCTTGCTCATGTCACGCATCAGGGCAATGAAATGCGGCAGATCCGTCTCTCCAACTTTGTGATAATAGAGGTCTGAC
TTCGGGCTGATATTGCTCTGCAAACAAGCTGGGGATTGAAAAATGGGAAATGCATCAGCCGCAATTTCCTGCAAAGCTTCCTTGAGCTCGAAAGTCGAAT
GTACAGCGTCAGGTTCAAACATCTGTAACAATTTACGAGTCATCTGGCCATCGAaacgaagttgaagacgcgACGGAGGCTCAGATGATCTttcagctga
agcagaagagcTCAAGTTCTTGTGCCTACCCCACTCCAGCCACGCTTTAGCGCTCTTGAAGTAAAAGTGAAAGTGCTCGAATTTCGTtgcttcatcacca
tcgccaGGTTCACTTATGGAGATAGAGAATGATCGTTGGAAGTAGAAATGTAGCTGGTGGCGCCGTTGGCATCCACGAACAAACCTTTGaagcacagcag
ctccatcatgacAGAATAACACACGGTTCACACTGCTCGTCAAAATATGTGGTAGCTCTCGGTGACTCCAGTCTTTGACAGCCACTTTCACACCAGCACG
ATTCACATCTCCCTCCGGAGCTTTCATTGCCTCCACTTCTTTGTCTCTTTGATCCTTGTCTTGACCTGACTCGCCAATCTGATCCTCTCGGCCAACATGC
TCTTTTATTTGGGCGCAGACTAACATCAACGGCTGAATTCGCATTGCTGCCGAAATGCGTCTAGCCACGACCCTCTTGCGCACTCGAgctttctcttctt
caatcAGTCGCATTTCTTCAGCCTTCACAGCCAAGCGTTTAGCTTGTCGAATACCGACCTGCCACTGGCGCCAGCAAACTTGTACTTTCGCCGCAAATAC
CGATACCTTGAGCAAATAAATGCGTGTATCCTCTTGGCGTTTCGCTTCTAAGGCTTCCTTGTACTGCAGCCGGCATATTCTGCCTCTCCAAATCGCCTCG
AttcttgttgcagcattTACCTGGTGACGATTCTTCTGGTGGAATTTCTTCACTGTACGCGCGATGCACCGACCACTGAATCGGTACAACATTTCGTCGA
GCTTTCGCTGTCGTTCCCGTCCCTCTCGTTCAGAGGCCTTGTTTGATTCGGTTGCTGGTAAAGACTGCTGATCTGGGACCTGCACCGCTGAAACATTTCG
CACCTTTTGGAGACTCGTGTTCTTGATGTCTTTGCTATTTCTACAAACCTGCATTCCGAGGCGAAGGTTCTGCCATCTTTGCCACTGCTTCTGTATCTTG
AGCGCATTCATATTTTCACGGTGACGAATACGTTCTTGCGCAACTTTGCGTCGGTGGAGTGAAATTCCCCAGCTCCGCTGAATTTTAAGCGAACTGGCAT
CCTGCTCCTGACGAATGCGCTCCttttcaagctcttcttgatgatggtgatgccaCTTGAGCCAGTGCCCTTGTATCTTGAGCGCACTaacgtgctgcag
atgttTCACACGCTCATTCTCCATTTTGCGGTGGTGTTGTCGCGTCCCCCAATTTCGCTGAATCCTCACTGAGATCGTAGTTTGGGCTTGTAAAAGAATG
TCCTTCTCGCGTTGCTCCGCACGGTATTCGTGCTGCTTCCGCCAAAATGATTGAATTTTCAGAGCGTTTGAGTCCTTCTTCTGTTGGAACTGCTTCGCTT
CCAGCTTAAAGCGTTCCTTTTCACCCTGTTCACGACACGTACGGTAACATCTGCGCCACAGCTCCTGAATCTTGGAAGCACAGGCATGCTTCTGGAGTTG
ATACCCTCCCACTTCAAGAATTTGTCGTAGGTGTAGAGCCCTCCGCCATTGAGTTTGGATAATCAGTGCAGCTACCCTCTTTTGCTCTTGCTCGTGTAAT
CGTCGAGCGAGTTCTTGTTGTTCGGACTGTACCCGATGCCATTTCAGCCATACTCGCTGAAGTTTTATAGCACTCGCTTGCTGCTCTTTTTTTATGAGTT
GTCGCGTTTGTGTCGCCTGTTGTCGATATTGCCATCGCCTCCACTTCCGCTGAATTACTAAAGCGCCACAACCACGACGTTCAACCTCCATCTTTCGCCA
AGCACGATGTTTCATCCACATCTTCTCGATCTTGACTGCACTCGTGCGTTCTTGCTTGTGGCGTCTTATTTTTTCTGCTTTGACTCGTTGAAATTGTTCA
TAGGATCGCCAGAGTTTCTGTATTCGCATCGCATTTTCGTTCTCACGTTCGACACGTACGCGTTTCTCCTCTAATTGCCATTTCCAACGCCGCCGTGATC
TTTGGATTCGTTCAGCAGCCTTTGCTTCGAGTCGTTCCTTTTGCCGTCGCTGCCACCATTTACAGCAGACCGTTTGTATCTTAAGCGAGCTTATCTGCAG
TCTGTGTCGCCTTTGTGCATTCTCCTTTTCTTGCTGTCGTTTGCGCTTCCACCGACACCAATTTCTTTGTATGGCAGTCGCTGCTAATATATGTGACCTT
CGTACGCGCTCTGCTTCTGCCTTCTTTTTCTGTTCCTCATCCCACTTttgccaacgctgctgtATTCGTTTTGCGCTCAACTCGCGTATGCATTGCCACT
GATACCATCGCCGCCAGATTTTTTGAAGCCTTCGTGCGCATACTTCTCTTCGCATTTGAAGCTGCCgtttttcatcttcagcctGTCGGCACCTTGTCCA
CACTTGTCGTATCAACTGAGCACTCGTGTCATGCACGATCCTAATGCGCTCAGTTTTTTCacgctgatgttgttgccactttctccatcttctttGTATC
CGGTAAGCACTTACAAATTGCTGCCGCTCGATCTGTATGTGTTCTCTTTCCAGACGTCGATGGTGACACCAACACCTCCAGATTGCTTGAATTTTGCGCA
CATTGGCTTTACGTCGGATAGCATCCAGATGCGCTTCAAAAGCTAGCTCCTGTTCGCGTTGTCGTCGCCGTTCCCGAGCCCAATGTCTCCACCAAGCCTG
AATTTTACGGGTTAATGCTCGCCGCCGTAGTGCCTCCTCCAATTGTGCTACCACGATCTTTTCAGCACGCTtgattttctgctgctgcatccaacGACGA
AAAGCTCGTTGGATCTTTCGGGCAGAATTCATCCGCTGTAAATGCTTCAGCCTTTGAACTTTGTGTGCTACAACTCGCCGAAGGTGTGTCGTGCCATCAA
GTGCCTGAACAATGCCGCAATTGCTTTCGCGCTCAGAGAGGAGCTTCACTTCAATGATGATCTGTACCAACTGAGCTTGAGTGCGTTCTGCAATAGCCTT
TTGTCGGATAGATCTATCGTGCTCTTCCACTCGTGCTATTGCCATAGCTCGACTATTACGGCGCTTCACAACAGTGTGGTGTGCCAGATTTGATACCTTT
ATCGACGTGACTTCACGCACCCTCGTTTCGAGTTCTTTTCGTTGTCGCTGCTTAATCTCTTCCAAATCATGTTCAGCTGACGCACAAATCTCAGCTtgtt
gtttcttcaatttTGAAAGTTGCAGGTGTCCGGAGACCCAAGACGCTATCTGCTGCATACTGGATTCGACTTTGCTGTGTTCTAGCTGCCGGACTGCTTC
ATCGATTTCCTGTTGTTTCTCCTGTGCTAGTCGGTCTTTCGCAATAACCAATGCATCTGATTGCTGCTTTAACTGTGAAAGACGCTGAGTGAGTTCCAAC
GCGATTGAGGTCGCCGTCCGATGCTTCTCGAACTGGTCTTGCTCAGACATCAACTCTAACTCCGCTTTCTCAGCTCGAATGCGGACTTGCTCCAATAAAA
TCTGTTGTCGGTCCTTCTGTGCTCTCCTTGCTAGCACCCGAATATCGATAAATGCTTTAATGGTCTTTCGAGCTGCAAACTCTAGGACAGTTCTTTCACG
TGCCTCGTGGGCTTGGATAACTGAATGATGGTGTACACTGGCTTGTGATATTTGCTGTGATAGACGACCAATTTTGCGCTCTAGAACCCGCGCCTGTGCA
CGCGATTTACCGACGTGCCGTTGAGATTCCACACTAAGTTTTTCCTTAGCCCGTCTCTCCTCTTGAAGCTTTAGCTCAAACCTGTGCTTCTCGCTCTCAA
CTCTCTGTAACCTTCGGTGAAGACAACAGACCTTCAGAAACAATTGGATTTTCAGTGCCGCGAGCTGCCTTCGCCTCATCTCAAGCAAgtgtttctgctg
ttgcacggTGTGTTGTCGTTGTGTGAGTAGCTGCACATTTTCCAGCTCCGAGGCCTTCCATTTACTATCAAGACCTTCCAATTTAGCATTCATATCTGCG
ATAAGCTCGCGGTGATGCTTTGAATGGAGCTCCATGTTTATCTCTGCATCACGCTTAGCTtttgtccacttcaactgcTCCTTGAACAGAATAttcttcg
tcgtctcctgAGCTGCTTTCAATTTACGGCGCAGCACAATCTCCTTCAAAAATCGCTGCACTTCTTTAAGTGCATGTACTCGTCGATCTCGTTCTCGACC
GGCTTTATCTTGCCGTTGTTTTTTCTTTCTCATTCGACAACGCTggcatctccaccaccgaaaaatcttctccttggcatCTTCTCGCttgtgtcgtcgt
cgtgataTACCCACAAAAAATAATGCGCGATGGAATGCCATGTGAACCGAACGAAAAGCAGCTTTCCGTCTGAAAGCCTCTCTGTTATGACGATAGATGC
TCCagttttgctgcagctgagaCGCCGCATGGAAGTATAcgcgtgcttcttcatcctcctgTGCTTGGACGCGGAGCTGATAGTGGTGATGTATGAATTG
CCAAATTCTCCGTTTTGCGGCCGATCTACGAACGAGCCGCTTTGCTCGTCTTCGTTCTACGCACACTTCTTTCCAAGATGCGAAGTTCCGACGGAGCATC
TTTAACTCGCGCTCCAAATATTGAGGAGCGTTGTCGATGTGGGCATTTGGGGAAGAGTAGCCCATTGAGGATGAGAATGACTTCGCCACAGTTTGAGCAT
GGCTTTCGACCTCGCGCTGCGATGTCCAATGATTCAAGTCATATGCTGCAACCTGAATATCTTGGCATAGCGAAAAAATCCTGTTTATACCGTTGgagcc
ttcttgagcattgTCATCTTTGGTTCCTTTGGCTACTGGGACGCTGTTTGAGGAAGGGTAATAGGCGGGCATATCATCAACCACGGACATGGGAGACAAG
CAGAATTTCTGCCACGGAAGCTCAGGGGTTTCAATGGTACGATTAGTAGTAAACGCATAGGCCGGTGATGGAGCAACTTGATGGCCAGAAAGCATTTCAG
GGGAAACAAGTGTATCGACAAATGATACTTGAGGCAGAAGACTGAGCGCTTTAGCAATACTTGACGTGTACGAAAATTCGTCCTCTGGTGGCAAGATTGT
CTCAACCTTCATCTCGACGTCATTCAGCTCATCCTGTTTATCGACTTTTGGGATGATAACACCTTGGCCATTGCTTTCGAACAAATATCTTGAAGACGTC
GCAAATGCTTCAAGAGTCGATGAATTAGCACTTATACCGCTGAAATTAGCAAGCACGGCGGTGCCTTCTGCTGGCTCGACAGTGTCTTCAGTTGGACTGT
TTATTCCATTGTCACTCATTGGTATTGCTTCGTCAGACGtttgagcttcatcaactaGCGACAGCTCGGAGTTGAAGAACGAAAAATTTGGAAGCATATT
TAACGCTTGTGCGATACTGGACAACGCGTCGTTAGAGGAATATTCAAAGTCGCAGTCATAATCACCACAttcaccagcttcagcaccaccatcttTCGGA
ATCTCACACTCAGGTGAACTATTTATCCCCTCTGCTGAAAGAACCATCTCATAGTCATTCAAGCCAGGCTCAATATCCACGAGAACCCCAGGTTCGTCAA
GATGAGCCAAATTGCAATCAAATCGCTCCGATGGATCTAACGTACCAATATCAACCTTAGGCATCATCGGAGATTCGTTTGCCACGGAATGATCTCCTAT
CATGTCAAGGTGCAAACTTTCTTTACAAACACTTCCAGTTGGTCTTTGTTCCACTTCAATGCGTGCAGGTGTTATCTCGCACACTTCGATCGCTTCACCT
CGTGCTGAGTTAACCAGCAAGTCCTTCGTTGTTGGAATTGAAGTCGCTGATTCGCTTTCAGTAAAAAGATCATCTGGTGTGGTCCGTTCGGTCATTTGAG
TCTCTGCATCTATGAAGATACCAGTATTGACCTTCGTCTCAATTCTTTTGACAGTTTTCTTTGATGCAGACCGTTCCGAAAGAGTGCTTCTACTGGATGA
TTTggcctctgctgctgtatcgGGCAAGGGAAGCTTCAACGTGATCCGAGAAATTCCAGTATTTTCGCTAACTTGATCTCCATGTGAAATAATTCCCACA
GGCGCTTTTCTCTGAGGAGATGATGCGATGAAAGACAGCGGGGCTGACACAGCGGAGATCCGCGTATTCGCACTGTTCGACTCTGGAGCTGTTATTCTCT
CTCCCCATGCGGATGAAGATACGGATGAAGATCGGACACTATCCTCTTTCGAAGACAACTCCATGGTTGCCTCCTTTGGTGTCTTGGATCGTATTGTCTC
GATATCTGGCCTTGAAAGAGATGGGGCGGAATCGGAGGTCATCAATTTCTTCGCTATTGGTGATCCACCCCACGCTTCCGTTACAGATATCGTGCCTCGA
GGTATATCGTGGTCATTCGTGATAGATGATCGAGCGTCATGGCGTGTCAGCCATGGCATTTGCTCGTCTTCAAACATGCCATAGCCAAAAGAAATTTGAT
CTACCCCGTGAGGTGGCTGGAGATATTTCCTGTTGTCGCCGTATGTTGTTGGAGGCTGCAAATATCtgggaagctgctgaacagcATTGAAGCGCGTTTC
GAGGtccacaagatgcagcaatGCCGCTGCCACACGCACTTTGGGAAGAACTTGCCAGCCAGGAAGGTATTGCTGCGTTTTCTGTGCAAATTCTTCCAGT
TTAACCGTCATAAGTCGAAAAagagatgacgatgagaaggaggctgaACTAAACAGAGCACCCGAGGATGCACTGTGGTGGCAAGAGCACAGCATCACTT
CCGAGGAGTCTAACGATAACCCGTCCACGAATGGATTCCGCATCAGATTCACCTCGAAGTCCTCGAAAAAACGCTGGAGGGGTGGTGAGCATGCCAGAAA
ATCCGTGTCAGATGTCATTTGCAGCAAATAGCTGTAAAACTCTTGCTCGAGGACATCGTGCTCGACGCTGGAACCTACTATACCGGGATCACCAAGCTCG
TTACTTAAGTAAaccaccgcctccaccaccgcgaGCGACACACTTCGCATCTTGttgagcatcttcaccacTCGCTGCGGCACGTTCTTCTCGACGTGAG
TTGCACGGTGCAATGGCAATACACCCAGGAGTTCTTGTTGTAAATGAGCCATCACTTGGTCACGCAGGCGCATGTTTTGTCTAATTGACCCCACTACGAG
CTGCACCGGCGACTGTTGTGTTGGTAGAGATCGGACAGACCGTTGAACAGCACCGATATTTACCTTGTGTGGCAATCGTTGAGGTAAATTGCGATTGGAA
TCAACGACCTCTGATTCATTTCGACTGCCCAACACCTGCTGCTTGAGTTTATACGGACTGGAGAGCCTTTTCGCTtgcgtctgctgcgtctggcGCCCAC
CACTCTGTTTACCTGCGGAATCCCGCGATGTCCTTGACGGTGGCCGCACTTTTGGCTCAGCGATGTGCTGACCATAACTGATGTGAAAACGCTGGGGGCT
TTTGTCCGGCCCATATTGTGTTTTCATATTAGGAATGCTCTCCGATTGCCACAGACCTCCTTGATCCACTCCAGTACGAAGAACCCCTTGATACAGTGag
tcatccagctccagctccactaACAGACGTTGTTGATCGTGGCGTCGACGGCCACCATGATCGTCAGTGGTATAAGCCGGAGGGCTTCTTCCTCCCCACA
CGTTGGACCGGCCAGCCATTTACTATTATTGTGTGGCGATACTTTAGTAAGTGACACCGTGTTCCATGAGCTTCGTGAAACGCTTTCTTGACGTTTCACC
AACCGGCCACTTCTTTTGTATGGGCACTGCTACAAAACCAACGCGATAAACAAAAGCTAAAGCAGAACAGAGCAATGAGTATGAAGCTCCTATCATTTTC
TTCAGATCGGCAATAGTGGTCAAGACCATATCCATATGTGTACTTAGATCAGCATATcggcatcatcttcgtccacacCGTTGCTTACAGTCGCTAGTCC
CTGGGCTTGGTACAGATCGGCAATCTAACAGTTCAAAACAAGCGAGCATCGCCCAGTATGCAACGTTAGTCAACCAACGCAGCGCAGCTTGTCACCGAAG
ATATTCGTACCTGAGAAGAGTTGGTCGCTTGGGTAGTGTCCTTATCGTCACGAATGCGAATGAAGCGAGGGAAACGCAGCGAAATCCCCTTATCCTTCGC
AACGAGGCCGATTGCAGCTGTATACTTCGGCGAGATTGACAAATCCGCACCTAAAATCTCCCACACGCAACTTGCTTCGAACCAAACATCAGGCTTGATT
CCGTCTCCGATAGCATAATCACTAGGAGGTTTGTCCACCACTTTTTCTTTGAGCTGCTCATAGAACTGCTTGAGCACCTCATCCGACAAGCCAGTACCCA
ACTTGGTAATTGGCTGGTACATCTCCGTGTCAGGGTCATAGCACGCTAACAAGTATGCGCCATACACACCCGTACGTTTACCCCGCCCGAAGAAAGCGCC
AATTGGAACCAAGTCAGTGGAGTCACCAATACCGTCGAGGTAGtctttcttgagcttcaacCACTTGTGCGAACGGTTCGCAGGCTCGTATGTCGCCTCT
TGCTCCAGGGTCTTCACCATCAAGCCTTCACAGTTCTCGCGCACGGCTTCCTCTAGGAACGTGCGCACGATGTTAACAGCTTTTTCCATCGCATCGGCAT
CGTCCTTGACGTCTACTccgtccaccacgtccaaCGACGACGCGAACTCAAAGTGTCCAGGGTTGACTTCGAACATTTCTCGCAACTTTTCACGACGTTT
TGCCAGTGGGGTACCGAGGAATGACTCACCGTTGAGGAACAGCAAATCAAATGCGTAGATGCAAACTGGCACCTTGATATCTTCCACTTTAATGTTCTAC
AGTCGGAAGCACACATACAAGAATTAGACGAGGCCCCTGTCAATGACCAAAGGCTTCAAAacagagaagaagcagtgAATTGAGGGCGTACCTTGCGCGA
TCGTGTACTTAGGATTTGGAATGGCAGACGCTTGTTAGTCGCGCGATCTACAGCAACCACCTCCGCATCAACAATGCAACTCGTGATGACGGCTTTCTTG
GAAGCGCTTGAAATTGCCAGTTTAACATCAGGGAATCGCTCCGTGGAGTTTTCGAAGTTACGTGAGAAAATTGAAATCTCTCCGTTCGATTGAATGTGGA
TCTGAGCTCGTTCGCCATCGTACTTGTACTCGCAAGTGAACGGTTTGCCTTCAAAGCGATCGAAAACCATTGCGTATGCCTTGGTCGGACGCGCTAACAT
TGGAGACACTGGTGTTCCTGGCGCCAGCACGCACTTCTCGGCAACCTTCGCGAAATCCTTCACACGGAGAAGGGGTGTAGTTGGCGCCTCCTCTTGAACT
TCATAGAACGCGGCAACGAGTGCGTTGTAGCTGGGACACTCGGCAAATGCCTTCTTGACGTAAGCAAGcgcattctgctgcttctcttTATCTTTCTGAT
CTTTCTCCGTCATGAACGCATACGTCAACGCCATTAGGATGGATTTCTCTGCCAAACCGATTCGTAGTTTACCCTGCAATCCCCGAATGATGTACTTGGC
GCCCTCAGCAGACTGCGCGTCCTTGCCCTGGGATTTCTTTTCTTTCTGGCACTTCACCAGCAAACCCTTGATAACGGAGcacttctgctgctgcgagtTG
TTTCCAGTCATCTTAGCGATTTTGACGAATTGATTGTACACGTGTTGAACGCTGAGCACGCTAGGCTTAGCAGACGCGGGCTTGATTGCTGCGAAGGAGA
GCGTGTGCTGCTTCGAGCGTGCATTCTGGGCTACCTTACCAAGATCCCCCTCTTTATGATACATCTCCTTGATGAACTTGAGGTTGGTGCCCGTGGCCTC
GCCAATAGCTTTCATCAAAATGGCGTCGCCGATGCCGATTTTCAGGTTCTCAAATGGTGGCGCAAGGTCAACGCAAACACAGAGGTAGATGCACGCCAGT
AGGTCGTCTGGCGAGTGACGAATGACGTCACGGAAGAAGTTCATCAGCAAGTCCTGAATGACGAGGCGACCCGAGACTACTTCAATCTTGGCAAATAAAC
TGGCGAGAGCCAAGTATTGCGTCACTTGGGGCtcatcattttcatcttcttgatccTTGGtatcctcctccttctttGTCTCGGGTTTGTAGTTGCTATT
GTCTTGTGCTCCTTTCTTCTCGCTAGCTAGGGCTCCCGTGGCTTTCTTTTTGCCTGATTGAGGCGTGAAGAATCCAGTAGTTGGCTGGGTCTTAACCGGA
GCAGGGGATGTTACCGTTTTCATCGATGCCTTCTTGGTTGATGCAGGTGACGTCTCTGTTTTCTTAGGTGTTTCATCCTCTTCCGTTATATCCTCAATCT
CAGCTCTGtgcacttcttcctcctcattTTCCTTCGCAGCAGGAGGCGTCatcagtttcttcttcttctgcttcttcactggACTCTTCACCTTCACAGG
CGAAGGCGACGACAGATCAATGACTTCttccttgctcttcttcttctcagtCATCTGCACCTCCAAATCACTGTCCGAatcctcttcctccatgACACGC
TGCCGGAGACGTCTGCGACCAGCTGCAAAtacaacaacagcaatacTCATCAGTCTCTTAATCAACGCAATAACTCCCAACATCCCTACGTTTGGGTTTG
GTCTTCTCAGactcctcttcttctttgtcaCTTAAAGCCTGGGtcttctctgcttcttccatAGTAAtatcctcctcttcttcttcctccactgGCTTTG
gtttctcttccttctttttcttctttggtgTCTCCTTAGGCGACGTCTTGACTTTCTTCACTGGTTTAACAGGAGATTCTTTTGCCTTCTCaacgtcatc
ttcaactgttttgcgcttcttgggcgGTGGAGTACTAGCTCCAGCACCGAAAAACGACCTGCAAGAGACgtaaaacaaaacaaaaaaacagAATGGGTTA
ATATTTTAttatttgttgttgttattaAGGATCGGGCACGACATACATGATGGAGCTCTGCGTCTTGGGCGCAGCAGCTATCGACGACACACAATAACGT
TGATAAGCAATTAGTGTAAGCTGTCAGATATCTATAGTATCACTATACAGCTCTACGATATACCATTTATAACGCACCTTTCTTCGCCATGTTCACCACA
CCGCTTGTTAGCGAATGACACATTATCTGTTGGTGAACGAAAAATGTACCCAAATGTATACCCAAACAGGTACCCATCCATTATGTATACTGTATACATT
TAATCGTACCCAAATATCTGGCGGGAAAATAGGTCGAACACATAAGCGTCAAGAATGGGTCGTAAGCTTCTGGCAGTGGTGCCCTTAGCGCTGCCGGCGT
CCGCCAAACTTGAGCGTTTCCACGCGGATGCAACGGATGATGCTCTGTTGACTGTGGTGATGTGGACTTGTGGCTCCAAATCTGACCTCCGTACTCGACA
ATTGGCTCTGGACAGAAGCAAGCAccaactgctggaactgcaaCGTATATATGCGCTTGAGGGCGAACGCAGTTGGTTTGTAGGCAATGACGTGCATCAG
GACGGCAGCTTAACGGTCTTCTCGCCAGTCGAGCCgttgtttgtgctgctggggGCTGCATGGACTCAACGCAGTCGCTTTCAGTCTGTCTACGACCTGC
TGAGTCAAGGGCAGAAcacgtggctgctgcagctccagacgCTCACTCAGGAGCGTATTGAGCTTGTCTTTGACGTGCAAGACGTCGGTGGGGAAGAAGG
CGTTGATAACCTTTATATTAAGGCTAATGAGAGCAAGATTCTCAAGTGGTTATGCTCCAAAGTGGAGCGTGTGGCTCATGTTTTGGCTAAGCAAGAGGCT
GAGAAGactgcaaaagctgcagggTCAGGAGCTTTCGATGCACAAGTTCATCTGCCTGGACAAAAGGTGGAGGAGGTTAAATCTGAGACTATTCCAGCTC
TGAAGACTGAAGATATtgctcgtcatcatcgcgAAGCAATTGAGGTGGTCGTGAACTACCTCCCTCAAGAGTTTGTGGAGCTACTGTGCAAGGAATTCAA
GTACGTTAATGGTGTATATCTGAGGTGCTGATATAGTTGCTTATACTTTGTGCTTGCTTTGTGATGCAGggtggacaagaaggtggaagTCAAGCCTGCA
GCTGCATTATCAGCTAGTGGGCAGATGGACTCGATCAAGCGCTTCGACCGTCGGCAGAGTACTGAGAACGGGTCGAAACGATCGACGCCTTCAAGTGCTG
GCAGtgcaaagaagaagagcaagctgGCGAATGTTGATCGCACGGGGATGAAGTCACTCACATCTTTTTTCACGAAAAAATAGTGAGGACAGGGCGAGCA
ATTGCATGTAGAAGCGATGCATCAATTGAATATATAGAGGTTTATCGTCGTGATGTAGAGCCTTCCACGCTCACCCGGTGCACTGCCACGAAGTCGTTCC
AGCCAGAGAGGATCTTGAACTTGATGAAGGAAGCGTCGGTTGGCTTGACGTTTTCGCTCACGATCTGTATCTCGCCATCGCTCTCTTTCAATTCTGACAT
GGTACAAGATTGGTTAGTGATTAAGAAGTAGCACTCAAGCCAACAGAGTGTCCTTGCTTACTAGTATCTGCTATCTTCTCCCATTTCGTAGGGGTCGGAC
CGCTGCAAGCTTCTACAGACAACTCCATCGCATTTCGAGTCCACATCTTGACACGCACAATCGACGCCGTCGTGGCAAGCTGAACCACAATTTCCTGTGG
AAAGCTCCCTGTTGTCACCCACTTGGACGATTGCTCTCTGCCCAAAGTAAAACAAACCATGAGCGGCCACATGTCCCCATCAATTCGTTTaagccaagca
gcaccacgaacCCGTCCAAAATATTAACAGGCGGATAGCTCGGATCGTACGAAGTCACAGCCGTCACCTGCGCACCCTCTTCATCCAAAGCGAGGTCCAT
CACGTTCACGGCGACCGGAGCACAACAGCGAGCTTGATTTTGTGATGCGGAGTAGACCTCCACTGCAATAAGTCCTAGGAATAAAAGCTTAACTTAGACG
CTACCGAGCCAAAAGGCAATGAAGACAGGACATATTTATAACTGATTGCACGACATCCATATTCATCAACCAAACCTCGTGCAGCGCTGCATTCCACTCG
CAACTAGAAGGCACTGTTTCGATCCTGCCCCATACGTCACTCATGACTGCATCGTTAACTCTGCGAGTCTAAAGGTGACTGTGTCGACTCCTTGAATAAT
CTCTCGAAGCCCCTAGACAATTGGTCGGCTGCACGGGTGATACCTGACCCGTCATCATTAAAGAGCTTGCAGTTCGACCACATCAGCTGAATATCGTTGG
CAAAGCGTTCGACATTCAGTTCTTTGACGCCAGCCACCGAAGCCTCAGTGTCCATAATGTATGCCCCGTTCTTCAGTTTTTCTTCGATCGTCGATAAGTC
CATCGGCTGCTTTACGATCCGCGTATACATGGGCACGTTCTCCACTGGCGACAAGAAAGGTTTCGCGAATGGATGCGACTTCAAACAAGTCACAATCTTC
AGACATTTGTCCAACAAGCTCTGCTCTGCAGCCACGGCACTCGAATATGCCTCAAATCGTGACGGCTTCTTGCACTCGTCACATTGCCAATCGCCTTCAG
GCAGGTCGCTTTCCTTCATATGCAGGCACGCCAAGTGGTAGGAACGTGGGCATTTATCGCAGCAAACTAAGTCTCCTGCAGTCTGGCACACCTCACAGAA
GTCTAAGTTTGCGTCCAGCTCGCTGTCTGACCCATCGGCATCCAtgctttcatcgtcatcgtctgcttcgtcttcatcgtcagcttcatcgtcatcgtcc
gaTGACTCCCCTCTTTTCGCACTCCTCGCATCATGGTATTTCCTCTTGGGAGGGCGACCAGGTTTACGACGTGCGACCTTCGAGCCCGAGTGCGCAATAC
CCGCAGCAGCATCCGTGTTGTACTTTCGCGGACGTCCCGGTCGTCGCTTCACCGCGACATTCTGCCCTTTCGCAACCGTAGTCTTATCATTGTACTGAGC
TGAGCCTCGTGCCAGCGGAGAACCCACAAAATCACTCCCATCTGCTTTCCGTTTCCGAGCCAGTGCTGATGTCAGTCCTTCTGCAGTATGCGCAACGCCC
TCTGGTCGGGTGCGAGGAGTAGGACTACCCCTCGAATCCATCGAGCTCGTTGACGATCGATCTTTATACGATGAAGTAGACTTCGCTGGGCTATCCGCTT
GCTCGTGGTCACGCTTGGCTGCTATTTCATTCGTGCCAAAACGTGTATCCTGCTGGTGGTCTCTTCCAaaggtggagctggtgctcgtATCCATTGCTAC
AGAGCTTCCAGGCATTGCGTTTTGGTGCAGCGCACTCAGCAATTGAACCAGTGATTTCTCAGATTCAGCACAATTCAAAACATGAGCAGCGGATGGCGAC
TCCACTGAGCCTTGATGGACATGTGGGGAAGCGTTTCTAGCAGCACTGGGTGGGTCAGTCGCCTGGGCATTATCTGCAATCATGGAAAGCATCTCGGCGG
AGACATCCTTCGCAGCGCGCTTGGGGACAAGAGGGGCTCGGGTtggcagcttttgctgcgcttgcaTATTTGAGGAATTGCCACGACTGTTCCTCTCAGC
ACCTACTGCGTAATGCTCGTGACTGGATTGTTGACTAGGCATTTTTCTGCGCTCTTCCCATCCATCTCCTTTCTCAGAGCTCCGCGAAGAATGCTCGTCA
CGTTGAGTGCGGTCCTCCGTTGGAGGTGCTGTCGGGATATACTCTTTGAATCGGCGGCTATCGCTACTACTTCGgttgtgcttgctgctgtataTCATAC
GCCCGTCTG