Description :
From Genome Similarity Track
Location :
Scaffold_24:896- 3545
Transcript NameFunction/comments
Sapdi_VS20SDRG_08031hypothetical protein

Sequence
2649 bases(100 bases per row)
CAAGCCTTGGCCAATTCGATTTCAAATGAAAAGCGGTCGACCGCGCGGCCTGGCGATGTTGCACCAGGTATCCGGATACTGTGGCTAATAACACGCAAGC
TGTCGCGGTGCGTTCGCGATTGCGATTTGATGGTCAACGTTGGTCAAAATACAAAATGGCTCCTACGTCGTTGAGTGATTACGTTTGCTTTGTATAGCAC
GGAGCACCAAGTTGCACCGTCGTGCGCGGCCTACAGCGCTCGAAACTCGTGTCCAAAGTGATGCCGAATTGCACTATTTGCGGCGTCACCAGGATTTATA
TTTGGCGTACGCCATTGTTAAGAAATGCTGCGATTCAAAACATACGCAGCCTCTTGAAGGAGGCCTATCCCCGATACGACGCTCTCTTTTACCAAATGCA
TAGCCAAGGTTGTCATGCCATTGGTATACGACCTTGCAGGTCCGTTAATTTATTGTACAGAGCCCCAGAAAATAACCTACGAAATAAGCAAGGAAAAAAA
ACCATTTTTGACTTTGCACATTGGCATATCAATGTTGGCAGCGCTTTGAGCCGAAATGCGCGTTCTCGATGCAGATTGCTTGCGTTCGGCAGCGGATGGA
TCGATCGGACGGTTGGCTTCCGAGTCACTGGATCCAAGAACCCGCTGCTGTGTTAATGCCATTTGATTCAACTTGAAAAGGCTGACGCGTTTATCCAAAT
GCACATAACATTACTTCTACTTCATCAATAGCCGTCAAGCTCCCGGACACCGTCCCAGTCCTTTGGCACATCAAAGTCAAAGCTCTTCATGTAGCCCATG
ACGTGGGACACGGGGCCGTCGCTCGGCCGCAGCTCCAGCGCAAGTGAGAAGGCAGTTTTGGCCCCACGCCAGTCGCCCTTGAGATAGAGTTCAACACCGT
TGGACGCCGCCTCGAGAAAGGCCGGGTCCAGACCCTCGCGAATCTCTTTGTACTCGGGATCGTTCTCGAAGTCCACGGGGATCTGCATGTCGTCGCCTTC
TTCGTCCTTTTTGAAGCTACGCATCGTGAGCCCCAGATGAATGCTGTCAATGGCTACCGAGGGGTCGCAAACCCCGGCTTGGGGTTGGTCACGTCAAACG
TGTAGACTGTCAGCGGCGTGTCCACCCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN