Description :
From Genome Similarity Track
Location :
Scaffold_941:896- 1963
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_941-fgenesh-gene-0.0Sodium/hydrogen exchanger

Sequence
1067 bases(100 bases per row)
CTGGACCCGCAGATCCTTTTCTTCGGGCTGCTGCCGCCGATCATCTTGGAGGCGGGCTTCAATACGCAGCGCAAGGGCTTCTTCTCCAACTTCCTGGCGA
TCCTGCTGCTCGCGATCGTCGGCACGCTCATCGCGACGTTCGCGACAGGCGGCATCCTCATCTGGCTCGGCAACATTGGGCTCATCACGCAGCTCACGTC
GGCCGAGGCGTTCCTCTACGGCTCGCTCATCTCGGCGATCGACCCGGTGGCGACGCTGCTCGTGTTCAAGAAGTCGAACGCGCCGCCGCTGCTCTTCAAC
CTGGTCTTTGGCGAGAGCGTGCTCAACGACGCCGTGGCGATCGTGATCTTCACGCTCTTCAAGGAGTTTGTCGAGAGCGGCAACACAGAGGTGAACTTTG
CCGTCGCGGCGTCCATGCTGTTCCAGTTCGTGGGCATCGGCGTCGGCTCCGTGGCACTCGCCGGCGTGATCTGCTATTCGTCCGCGTACATGCTGCGGCA
CTCGGACGCGGCGCTCAAGGAGCACCCGACGTACGAGATCTCGATCATCCTGCTCTCTTCCTATGCGAGCTACGTGACCGCGGAGCTCTGCGACCTGAGC
GGCCTGCTCGCCGTGTTCTTCAGCGGCGTGTTCATCCGCCACTATCACATGTACAACATCTCCAAGGCGAGCTCTTTCGCGTTCAAGCACCTGCTCTCGA
CGCTCGCGTTCCTCTCGGAGAACTTCATCTACCTTTACCTGGGCATCAGTGTGTTTGCATTCCGCGACTCGCTGCTCTGGGACTGGGGCTTCATCTTCGC
GACCATCGGTGCCTGTTTGGTAGCAAGAGCACTCAACACGTTCCCGTTGTGCTCGCTGGCGAACTTGGGCCGCAGCGCGCGCCGCAAGATCCCGTTCGCG
TACATGCTCGTGATCTGGTTCTCGGGACTGCGTGGCGCCATCGCGTTCGCGCTCGTGCTCAACGTGCAAACGTCGAACCCGGACCACGCGGCGATCTTGA
AGAGCGCCACACTCTTCACTGTGCTCTTCACGACCGTGTTCTTTGGCATGGGCACGAGTCCACTGCT