Description :
From Genome Similarity Track
Location :
Scaffold_5:895947- 897009
Transcript NameFunction/comments
g2999.t1hypothetical protein

Sequence
1062 bases(100 bases per row)
TTTCCAACACTCCTCCTCGGCCGTCACCTACGTCAACTTGACGATTTGGCGCAACTCCGCCATCCTGGGCGCCGGGAAGGCCTTGGTCAACAGATCCGCC
TTCATCAGATGCGATTCGACGTACTTGGGCTCCACGATGCCCTTGCGCGCGTAGTCGCAGATGAACTTGATCCGGATACCGACGTGCTTGGCGCTCACCA
TGCTGTCCTCGGACTCCAGCTGCTTGATGGCGGCCTGGTTGTCCATGTGCATGGGCATGGGCTGAGAGACGGCAAAGTGTAGCTCGCGCACCAGCTCACG
TAGTCCGAGCAACTCGCGTCCGACGTGGGAGGCCGACGTGAACTCGGCCTCCATCGTTGCCAATGATACGCCCGTCTGCTTCTTGCAGATCCAGTGCACG
ATCGCTCCATCCATGGTGACCACGCCCCCGGTCACCGACTTCCGGTCGCCCTTGTCGGCCGCGAAGTCCGCGTCGCTCCAGCTCTCTACCTGAATGCAGC
GCCCGTCGGCCACGCCGACGTCCATGCGGAGCTTGAGGGTCTTGGTGGCCTTCAAGTACCGTGCGATCCTCTTCGCGAGCTTCCAGTCGCTCGTCCGCGG
CTGGTGCGTGTACCTGGTCGCCTTGTGCACCGCGAAGCTGATGTCAGGCCTGGTGCACCGGGCGATCCAGAGCAAGCTGCCGACCAGCGACTGGAAGGTC
CGAATCGTGGGTTCGCCGTTGGAGCCGACGCCCTGCAGCAGCTGCAGCTCTTGGGGCTCAGCGTCGTTGGCCTCTTCGCCGATGGGCGTCTTGACGCCGT
TCGCATCCGCCAGACCGAACTGCACCAGCAGCTCTTCAATGGCGGCTTGTTGGTCTAGGTTGTAGCCGCCCGCCTCGTCGAGATGCACGCGCATCCCAAT
GAACTTGCTCCCCTTGCCCAAATCCTTGATGGACAGGATCTTCATGGCCACAAAGAAATCCTCGATCAGGTCCGGCTTGGACGCGGTGACCAGCAGGTCA
TCCACGTACAAGCCCACGATGGTCATGTCGTTGCCGTCGCGCTTGTAGTAGAGGCACATGTC