Description :
From Genome Similarity Track
Location :
Scaffold_165:89584- 92232
Transcript NameFunction/comments
Physo_144100WD repeat domain phosphoinositide-interacting protein 2

Sequence
2648 bases(100 bases per row)
GGGAACGGCCACACTTCTTTCGTGGTGTACCGCTATCCAAATCTGCGGATGGGGAGTTAAAAGGTTGCGCGGCGCACGATCTCACCATTTCATGCCATCG
ACCGCACCGAATACGTCCGTGAATAGCATCCAGGGTTCGACCTACACATGCTGCTTTGAAGGAGAGCCAACATCGGTAGAGCAAAGTTGCGTCGAGTTCC
GGGTGACGGGAGTTCGTCAGTTGAAGGCAATATTATAGCAAGGAGGGACAAGATGAGTCCCCAAACGGTTGAACAAGGCAAGTTGACGAATGACTGTATC
GACAGGTTTCTATTAATCCTTGAACAAACCACGACAGGTATGGGTAAGCAGCATGCAGCTACCAAGAGAATCGCCATGAGTGGTGATGATGAAATCTTCT
TTAGGATTTTAATGGCTACCATAGTAGACCAAATACAATCTCTTCTACTACTACTACCTACACATGCTGCCGTTGCAACCAACCAGATAACATCCACCCC
CAGTACATCGTCCTCGATCCAGTCGTCCTAGTGATGATGGTAAGCGCTCATTACCAACTTCAAAGTTGCCGTTGTTGAAGTTGCCTTTGCACTTAGAATT
AACCCCCTTCAAACCGATTACGTATTTTAATTGGTCGAAACTCGACATACCAATTTCAAGTGTAGATTATCGGAGGGGCATATCAAAAGTACAAGCAACA
CGAGAGAAGAAGAATGAGGAGCTCCGAGAGCAGCCGCACCGACCTGCTCTTCCTGAATTTCAACCAGGAGGCGTCGTACGTTTGCGTGTCTCCCGCTTCG
TGGCTGTGCTCTGCTATGGACAGTTTAATATGCACCAGATAAGGACGGTACTAACGCTGGGGTGGCTGTATCATCCATTGTTCTCAGATGCATCAGCGTC
GGCACGCGCCAAGGTTTCGCCATCTACAACTGCGAGCCGTTCGGCAAGTGCTTCCAGGAAGACATTGGCGGTATTGGCATTGCCGAGATGCTGTACTGCA
CCAGTCTGGTGGCTCTGGTGGGCGCTGGGGACCAGGTGGGGTGGAATGCTTCGTTTCTTGCGTTGTGTCACTTGGTCAGCGATTGACTCAGGATGCATTG
CTGCACTATGTAGCCGGCATTTTCGCCGAGGAGACTGCGTGTGTGGAACACCAAGACGGGGGCTGCAATTTGTGATTTGAATTTCGTCACAGCCGTGCTG
GCGGTGCGCATGAACCGACAGAGGTATCGGTTGCCACTGAGGCTGTGTGAAGGCGTATAGGAGTATGACACTGACGGGGGTGCTTGATGTCGTATTTATT
TGCAATGATGACTTGCAGACTTGTGGCGGTTCTGGAGCGCAAGATTTACATTTTCGATATCAGCACCATGAAGATCCTGGAGACGCTGGACACGTCGCCC
AACCCGAAGGCTTTGTGCGTGCTGTCGCCGCATGACAATGGCCACCTAGCATTCCCTTCCGGCGCATCACCGGGCGAGATCGTTTTGTATGACGCCAACA
ATCTTAGCGTGTTGAACGCGTTTCAGGCACATCGCACGGCCCCCGTGGCGATGGCGTTTAACCCTCAAGGCACACTGCTCGCAACAGCATCCGAATCGGT
AAGCAAAGTTCGATAGAAGTGCTGGTGCCTGAAGTTCTGTGCTAACCGTGGTTTGAACTTTATAGGGCACACTGATTCGGGTATTTGCTGTTCCTAGTGG
GAAAAAGGTTGCTGCCTTTCGACGTGGGTCCTACGGCGCTCAAGTCTACTGCCTTGCTTTCAACGAAAGCTCGACGATCCTGTGCGCATCTAGCGACACG
GGCACCATCCACTTTTTCTCACTGACTGGGGCTGAGAGCTCAGCTACTGGCAGCTTCGGCCACTTCACCCCGATCACTTCAACTCTGGCAGTTGCCGGGA
GCACATTCGGCTCCACAGTATTCGGAAGCGCTGCTGCTCCACCGAGCCCGATAACTTCATCAGTGGTAGACCCATCACCCGGCAAGCCTTCCGCCCACCA
CGTGTCGTCGTCTGCTACAGCACGTGGAACGCGCACCAGCTCAGGTTTAGCTACGAGCAATTTTGATGACGTCGCTGGCGTTATGAGTGCCTACCTCCCC
AGCTCCTTTTCCGGCATCGCTGAAGGCACTCGGGACTTTGCTTACGTACGTACCTACACATTTGTACACTCAAATGCCATGCCCTTGTCTAATTATTGTG
GTTGCTTATCAAATTACTTAGGCTCGACTTCGCTCAACCGGGGTACCGAACCAATGCGCTATCCATGGCCCGAGAGACCCCAAGAACCCAATTGTGCAGC
TGTATGTGGCTACAGCCGACGGCTACTTTTATGAGTACTCGCTGAACCTTGCTGTGGGTGGCAAGTGCAAGCTCGAGCGGGTAAGATGCTTCTCTTATCT
AAGTATCGACTACGAGTTGAGCTGACATTGCTATGCGTGTACAGGAGAACGTTCTTCGTGACAGCACCTCCGAAGAAATTGAGGCCATCTACATCTCGTA
GCATCTGCTAGCGCGATTTTTCATTGCTGAAAGCCTTTCACACTTCATACAGCGGGAATCCCGAGACGGCAGCTAGGAAAGGGGTATCAAACCTGTTGAT
AAAATAAAGTAAACGATACTCCCAATGCCAGATTAGAGCCAAACATCA