Description :
From Genome Similarity Track
Location :
contig_15:895788- 898244
Transcript NameFunction/comments
g4177.t1XP_009517233.1 hypothetical protein PHYSODRAFT_473346 [Phytophthora sojae
g4178.t1RAW32501.1 hypothetical protein PC110_g11167 [Phytophthora cactorum

Sequence
2456 bases(100 bases per row)
GGACGTGGCCTGGAAGTGCACGGCGGCGTTCGTGCTGGGCGCAGCGGCGCACTATTTCGTGTCCTCACAAGTACTGGGCGATGCATCATTCCTCAAGACC
CCAAGTAGCAGCATCAGCGACAAGGAGGAGACCCCCGAACCCCCGTCCAGGTCCTCGTCAGGTTCGTCAGACGACTGGGAGGACGAGGGCGAAGCCTCTT
GGGTGCCTCACAAAATGGTCATGTGCGTGCGCACCGACCTGAAAATGGGCAAAGGTTGTACCCACATGGATCAACTTTTGGGTATATCATACTGACGCAG
TTGGATTGCCAGGCAAGGTCGCTGCGCAGTGCTGCCACGCGACACTGGGCGCGTACAAGCGGGCGGCGAAGCGCACGCCGACGCCATCGAGCGTGGGAGA
TGCTGGGTCAAGCCAAGGTCTGCCTCAAGGTGGACTCGGAGGAGGAGATGCTGGCGCTGGCTGAGAAGGCGGCGAGCACGGACTCGTCAACTACGTCGTG
GTACGGCTCAGTTTCTGTGTTCGTGTGTGGAGACGTGAGTGTTGATGGTTTTTGTGTGAGTAGATTGACGCCGGTCGGACGCAGATTCGCCTGAGAGCAA
AGACGGTGCTAGTATTGGACCAGCGCCGCTGAAGGCAATTGACGAGATCACGGGCCACCTCAAGCTCATGTGAGCGTGAACTGAATAGGGATAACCCAGG
AAGAGAGACATCAACTGTGTCGGAGTGAACTGATGGTGTTTGTATTTAGCCTTTTCCTGTCTGCTGTGATGGCAGAGTGGAGGGCGGTCGCTAGAGCGTA
GCCACGGGATCGTACTGCGTGCGGCTTTTAAGGATGCCAGCGCGCCGTAGGATGTAGACGGCCACAGCAACGCACGTGATGGCGACGACAGTTGCTAGTG
CAGTCGCTCCGATTGTTATGTACACATCTGTCGCTGCCAGATCGTAGAGCGAGGAGCTGGACCCGGACGAAGTCGCTGAGTCCACGTCAGCCGGTGACTC
GGAGGTCGGATCGTTGCTATCCACGCGAGCGGCAGCCATCGTTTGGATAGTGTCTACACAGGCCAGGAACTCGCCCTGTGTCGTCCACCATTTGAGCGTG
CACAGCGTTTTCGCGTGGCAGACTGCGTCTTTGCAGGGTCGAGCATTGGGCGAATGGGCCTTCATATTCCAGTAGTAATCTTCCACCAAGGTCGCGTTCT
GCTCAACGCGCTGCACAAAGGCCGCGAGCTCGGACTTAGATAGTGACTTGAGGCCGTAGGCCTCACTCGCTCGGAACAGAAGCTTCCAGTCAAGCTGCGG
GTCGCTCTCGGCGATAGAAGAGGCATACACAGCGTAGTCGAGCACGTCGTACGTCTCGGTGTCGTAGTCCCAGACCATGAAGGACGGGTTGTTGCCGAAG
AGCGGCGAGATGGAGCCCGTAATATACATAGGCAGCAGCTGGAAAGCATCATCCTCACCGTCGAGTGACCCCACAGGCACGCGGAACTCGATACTGTGGA
CATGGCCGAAAAACTGCGCCTTGATTACGTCGGCATACTTGCCAACGATTTTCTTGTACGCCGCGATGTACTTGACGTGCCACTGCGGGTTGCCTCCGTA
CGAGTCCACAATCGGAGCGATGTGGCCAGCAATGTATGCAAACTTCCCAGCGTCCTGCAGCTCAGCAAGGGTCGTATCTAGCCACTCAAACTGTCCAAAC
GGGTCTGGCTGGTCCGAAGTGTCCGGCAAATGACTCGGCTGCACAGCAACAAAACCCATCAGTCCCAGCCCAATCTCCAAACTTGCAGAAACCTACCGAG
TAGGGCACTGTGTTCAATGTGACCACGTGCAGCTTGTCATCCAGTGGGTAGCTCAAATATCCTCGTCGGTTTAGCAGGTCCATGTTCGCAGCCGAGAGCG
AGTCCTCCCACACGCCCGAGATGATCTCAATGGATGGGTTTGTCTCCTTCTCCGGGTCCGTCACCTCCATGTGATAGTCTGGGTCTGCACCCGCATCAAA
TCACAACAATAAGGATCTCTCCACAAAAATACCAACAAGAGTCTCCTTACTCGCGTCTGCATTGCCAATGATGGCCGTGGCCTCGAGTCGCCCGTCCTGA
TTCTTTGGCGGGAAATAATTCTCCATAACGTGGACGTTAGTCTCCACTGCTTTCGTAATGTATTCATCGCTGAACAGCCCGTGGGCTGCGTGGTCCCCGT
GTACAGGAAGAGATCCGGGTCGTCCACACGTGCATCCTTGGGAAGACCAGCGCAGACTCGACAAGGGCCAGTGGGGCGTCCGCGAAGTAGCGGATGGGGA
CGCGCGCGTTGTCCACCGAGGAAAAAGACGCGGAGATATTGAGGTGCACGTCCGAGAAGTGCAGGATGCGCCCCGCAGACGCCGGCCAGAGCAGCAGCGC
CCAAGCGAGTGACGTCAGCCCCAACATCTCTAAATGTGAGGATCAGAGACTTCCGA