Description :
From Genome Similarity Track
Location :
Scaffold_89:89542- 91741
Sequence
2199 bases(100 bases per row)
GGTGATCAGGATGCGAGTATTCAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGCGTTAAGCTCAAGAG
TCGCTCGAAACACTTCTTGGCGCCTGCATCGGTAAACTCCATGTCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACCGTAGGGCGA
ATACCAGATAACACTCGGTGAGGCAACGGCTCAACCGACGGTGCACCACCACGACGCGGCACCGAAGTATAGGTTGCCGTGATCATGCGCCCAGGTCCAG
CGTCGAGGGTCCAAGAAAACGAACGAGGAGACACCGGAACAGGAGGTGAAGATGGTGGTGCTTGGTGACTTGCCGGTGACGAAGGAGGCGGACCGCCGAC
TATGATTGGAGAAGTAATCATCGGCGAAGGATTTGGCCGAGGTGGAGTCGGAGGACGAGCTGGGCCAAGACCGCTCCAGTTGCCGTCGGAATCTTCGACA
TCTTCGTCATCGACTGCGCTTGAATACTCGGTAGGTGGCGGAACATCACCGCCACCGCTTGGACCATCAGGGGAATCATCCACCGAAAGCTCATTGTCAT
CCACGTCACCTTCACGATCATCATCAACATCTCCATCGAAAAGTCGGGCGAAGACACGCTTGGTACGACAGCTGTCGGAACAATCGGAGCCGGCTTTGAA
GACACGGAAGCTAGTGGAGCAGCCTCAACAGGGGCAGACCCTGCTGTAAAAACCACTCCCGAGACTTCAACTGCCTTGGATGTCGCGGCAGACGCCGAAG
CAGACTTGCCTTGTGGGACAGTCTGGTCTGACTCTTCACCTTCGTCACTCGAGCCAAACATGAGCCGCATTTCCTCGGCCTCACGCATAGCCTCTTCAGC
AGCACGTATGTCGGCTGGAGAAGGTAAAATCGTTGAAGCTGGTGACTTGGCCACATCGTGTGGACCCTGAGGCGGGGGCGAAGGCGCGTCAGGAGAGACA
GGAACATCGTCGTGATCCTCAGGGTTCACGTCCTTAGCTAAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGGACGCTGCCTTGATCTGCAGTCCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN