Description :
From Genome Similarity Track
Location :
Scaffold_77:89523- 96571
Transcript NameFunction/comments
Phyke_g3266phospholipase D; Pi-TM-PLD
Phyke_g3267tubulin-specific chaperone D, putative

Sequence
7048 bases(100 bases per row)
TATCTCTACGCGGGTGTTCTCAACTCCCTCCTGGGCAGTTTCCTCTCCGCTAGTGGTTATTGCTGCCAGAAGTACGCACATATCCGAGCGGCTCGTAATA
CGGCGATAGGCACAGCTACCCAGCAAAGATCCTTCGTGGCTGGACTGTTTCTATTGGGTATTGGCACCATCTCCGCTGTGGTGAACCTTGGGATACTCGG
ACAAGCTGTGCAAGCTCCGTTTGCAGCGCTTACGCTCATCTACACTGCGTTGCTGGGGCGATTCGTACTGCAGGAGAGTTTTGGCGTCTACGAATTGCTG
TCAAGTGCACTCATCATCTTGGGTGTAGGAGTTGACGTGTTTGCGGCGCAGCTTGCCAACGTTCCACACAAATCGTACACATTGGAGTCGCTGGGACGAC
TACTGATGAGAGACTCAGTCTTCCCTCTCGGATACACGGTCGCAGCACTCGCCTACGCTATGTTGATATTGAGACGAGTTCATACAAACAACCTGCAGCA
CCGTCCGGTCGGATTGCTCGCCTTCAGCTCATGCGCCGGAGTCATGGCAGGTTTCACATCGCTGGCTACCAAGTCTGTCGTTGAAGTGGCTAAGTCGGCG
CTCCGTGACCAGGAGTGGCTGGATTTCTTGAACccgttcttcctcttgatGGTGATCGCTATCCCATGTGCGCTGATACCACAGCTATTTTTCCTCAACA
AGGGACTAGAGTTTTTCGGCACGCTCAAGTTTATCCCGCTGTACCAAGcgttcatcatcatcggcaACATGGGTTGCGGCATGATTTTCTACAACGAGAT
GGCTATCTACAGTTCGACGGCACTAATGTACTTTTTGGGCGGTATCGCCATCACCATTTGCGGCGTGTGCGTCTTGCTGATCAAGGTTGACTATGAGAGC
AGCGAGGGCAATAGCAGTCGTCGTTCAAATACAGTGAGGGCTCTCGATCGACCGAtgcacgagcttctcgacAGTAAGAGCACGATAAAAAACCACTTCG
CCACGGACTTCACGTTCGAGCAGATGAAATGGGCCCATGAGAGCAACGGGTCTAAAGGAGATGGATTGCGTGCGCTCCGCGACTTTCGTGAGTGCCAAGA
GGCCATCGTGGAACTTCTTGTCTCAGCACGGAAATCGATTTACTACTCAACATTCCTGTGCGATTTTACCCAAGTCTTGCAAACTACAAATGAGGGACAG
ATGGGCAACACCTTCGTTTCATTGCTGCGGGATGCTGTGGAACGTGGAGTCGATGTGCATATTCTATACAATCCCGTTCGTGATTACGGAACGAATTCAG
TCGCCAACCTGCGCCGCATATTACCCCCTGGCGTGCACTTTGCCTGCTCTGTCAGTGACCTCGGCCCAAGTTTCTTCACACGCTGCCTGTCCAATAACTC
CAGGTAtgccttccaccaccagaagtATCTGTGTATCGACGATGAAACGCTCATGGTCACGGGTTGCGATGTAAATACAGAGCGCGAGGGTTGGTTGCGT
AAGAACTACCTAGGTTACTACTGGCACGAACTGGGCGTCATCTGCCGTTGTGACGCTGATATGGCCCGGTGGATCCATTCGAACCACGAGCCGATCGAGG
AAAAGCGCTATTACGACCAATTCCTGGAGTCACCGCCGTTTCCGCTGGTCTCCGGTGGATGGAGAGAAGAGAATGCTATGGTGAATATGATCATGCACGC
CAAGCATTCGGTGCAACTAGAGAACCAAATCTTGATCTCAGGTGGAACACTGCAGCACAATCGTATATGTGCCGCCATTGTTACGCGTATCAGCCAGGCG
CACCATAAGCGCGAGCCATTCCACGCAATCATCCTGACAAACGCAGCTCAGAAGGATGAACCCTCTCAACTAGCCCGCATATACTGCACACTTTCGATTC
AGTGGTCTCTGGAGCATCTGGAGGACTGTGCGCTAGCCCACGGTCTTACGTtggacgagctggacaagTACCTCTTAGTCAGCCGCTTGGAGAATGATGG
CATGCTGATTAAAGTGCATTCGAATATCCTTATTGTGGATGGAGAATACGCTGTTAGATCATCCTCGAACCTGGCGGATCGTAGTTTGAGCGCGCGCCCC
AATGACACGGAGCTGGGACTACTGTTTTCGGGACCCTGTGTTAACAAACTTCAGCAGGACCTTTTCAACATGTACTTCCATACGACAGACGTGGTATACT
CGATGTCTCGAGTATTCGAGCTCATCCGAGGCACTCCCACAAAGAAGCCGACAGGTGTCATCTTCCCATTAAAAAAGAAAGCTTGGAGCCCTGTGTTCAC
ATGGTTCATGATGAACTTGTTCATATACGGTAGCGAGGGCGCTACAGGTGGCCGGATCAAGGTGACCTATGAAACCACTGCCATCGGTGAAGATAAGCAT
CGCTTCGAGAACTAAGTCAATGGCGGTATACACAGCATGTTTTGGGGCGATGTGGACACAACACACGCACTAATAGCCCATTTCTTTAATAAGAGTCTTG
TAGCTTGTGTCCTCTTGGGTAGGTGTTGTCGTATCAGGTGTTCGTGCTTCCTGTCCCGTAGATCTGAACAGCAGACACCGATTACATCATCCATCACTCC
AGTATGAAATGAAAACGTGAGGACACGTACAGCTTTTTCGAAGGCAACTCCATATCTAGGAGCTCAAGCAACTCGTTTCGGGCGGTGCGGACTTGAGTAA
TCTGTTCAATCACGAAACAATTACATACATACATGTCAGTTTGTTGTGCTACCCACATATACTCGACGTTGCACTTACCGATGCGTCCCACGCAGTGTCA
CTCAAAATCTCGACCACTTGATCATACTGCAGGGTGGATGTCACATTGCAAATATTAGTTGTGAAATGAAAGACGTCAAAGCCACACCACGTTCACCAAA
CACGCTGACCTTCTCCTCATTGATGACCtcttcgtgaagaagcaaGCGCGTGTAAAGCCTTTCGGCCGTTAGCTTCCGCACTTTCGGAAACCGATGTCCC
AGGAACAACACGAGGGCTCGTAACGATTTTGCTTCTATCTCGGAGTCGCTCGGAAGCAAACCAATCAGCACACTAATTGCCGCATCAAGCTTCGGGATTG
ATATGCACTTTTGAATCTCGTCACGGAGCGCTTCATATAAGCGCTCCCCAAAGTCTGTAGCTGCCATAACACTGCCATCGTCCGCTTGGCGCTCCTCAAA
TAGAAAGCGTAGCAGGTTTGATTCTAGTAATGATGCCATAGTCTTCATGAGGGGAATCGTGACGCGGTCATCGTGATGGTGCCGCGTCAGTAGAGTCACC
AAGAAAAAGCTAAACCGGCTCAGCAGCCCAAAGTCTTTCGACTGCACGTGAGCTCGGACCCACTCAAAGAGAGAGCTCTTAGACGCCTTGACAACACTCT
CAGTGAGCCCTCCCACACTCACCACGAGACCCGCAGCGACTTCCTCCATAAACTCCGGAATGTCCATCATCTTGACAACTAACGGGAAGGTATCGTGGGC
CATGGACCAGTTAACTGTCAGCGACAAAGGGAATATTTGGTTCTCGAGCTGAAAGCGGTCCGGAATGCCGTCAATTCGAGGAGATGTCGAATGCAATAGT
CGGAATATAATGCTTCCGGCTGTCACCCTCATGTTATCAAGTTTTTCTGCCAACTGCTTGGACAACGCCCCAAACTGTTGTTCAATATTTCAAAGACGAC
AAAAGTTAGTTCGCCCCTCGGTAGTCAAACAGTTATCGCACACCAATAACTTACAATCGCGCCTATGAGAAATGGTGACAATCGACGAGCAAACGGCGTT
GAACATGGTTGGTTCAGTTGTGTCAGTTCTGCAAGTCTTGTGCGCTCTGGCATAACTGGAATGTGGAAATCATCGCTTTCAGAACTCGATGTATCGTGTC
GAGGTTCGGCGCTATCACGCACAGATAACCGTTTGGCATGAATAAGCCCCACCCCAGTCGGGCCGAAATAATAAAAACCAAGTGCTGGCTTCTCGAACTT
AACGTAGTAAACCGAGCCAAGCTCTGAATCCCCGTTGAATTCTTCATGCTTGCGTTTTCTGTCCGATATACCGTCAACAATGATACCTCGTCCATAGTCG
GTTTGAGTGGCAGCCCCAATAAGACGGAAATTTTGGTTGTGCGCATGGGTACTCTCGCCCAGAAGTAGTTTCTCTAGGCCCACCATAGCTTCCTTGCGAA
CCCACGACCCGACATCTCCGCGCTCATCGACCCTATAGTCACAATGGACGCATTTGATGAGCGTCTCGACAATAGCATCTTCCATGTGGTAAAGGTCAAG
CTCGGCTGGTGGCCTAGAGCTCAGATCCACTAGTgcttgaacagcagcaacacgacTTCCCGGGTCCTCATCTTCTGTTGCTTTCTCCTGAAGCGATGCA
GCTCTTATGACTGTATTGAGAGCATCCTTCATGCATGGCTGGACTAGCTCCTTGGCGGCCACACCAACTGCACGCAGGAAACCTCGTCGTGCAGCTACAT
TTGGATTCGGCGCGACGACGGACATACCGTTTTCCTTCGAAGCCACCATGATGCCAGAGTTGATGAATCTCGGTATTAGCCCTTGTATGTATCTTACGTG
AGCTGGACTACCTTTGCCAAATATTTTAGGACAGTACTGAGCCGTGAACGCACCAAAGGCATCAATAGCTGCGTCGCGGACACTCTCGTTGGGGTTCACA
AAGCATTCTTCCAGCATCGCCAAGTATTTCTTCACATGAGCGAACCCTAGGCTCAGTCGAGCGTTCGAGATCACTTCAATAACGTTACAAACAGCCCCTC
GAATCATTTCACCACCGCGGCCACGGAATAGGCGCCTCTTGTCGATCTCGATtggcagcatcttcacctccttTTGCAGTTCTCCATCAATAAATACGGG
GACCTGGACTAACGCCATGAACAACTCAGCGATGCTGATTAAAGCGCCATGTCGAACGATTACTTCTACGTCTGGAGAGATGGCAGAGGCAAGAAGCCTC
GGAAATAAACGCGCCATGGCATACGTCGGGTCCAAAGCTGCAATCTTcccgagagcagcagcggcaagGTTCCGGATCTGAATGTCCCAGTGCACAATCT
TGGAAGAAAAAAGATGTTCTGAGAGCGGGTAGCGATACTCTGGGTACTTTGCAATGAAGACGCTCACATTCAGATATGCATGGCGCAAATTTGCCACTGA
GAAGTAGTCCGCCTTAGTAAGCAAATCAATGCCGTTCGGGAAATTAGCAACTCCTTGACGCCCAACATTTTCTTGGAAAGCCGCTGATGCTGCACGGCGA
CAATTTAACTCACGGTCGAACACGCAGTTTACGAGCATTGCCGGTGCAAGGGTCTGCTTCAGCCATGGGAGAAGTAGTGACGGCTCGTACGCACGAGCGA
AAGACCAACATGCATAGCAAGCAGCATCACGAACATGATAACCAATACTGTATGTGCCTTTGCGAATGTCATACCGCAAGGCGTTAGCCACACAGTCCAC
AGCATCGGGCAGGCGCTGTGGTAGCAAAACACCACGCCGGGCAAGCTCTGCTAGCGCCAGGCTTGCTCCATGCCAAGCCCCGTCATCTTCCGTCGCCACA
AAAAGTTCTAGCACAGACTGGACAATGTCATCCGCAAACTCATATGGTAGGCGTCCAGTGATTCGTCCGATTCCTTTTGCAGCCGACCACCGCACCACAG
TGTCTTTATCTCGCAGCCCACACAAAAGTACTTCAACTATTTGCTCCAGCTCGTCTACCACTTCGAAcgtttcttcgtcatcactgccaTGAATGTCGTG
CACAGCTGAATTACCATCTTGCCGACGGCTTGAAACGGAAAAATCGTCACTTCGACCAGTATTCAGCCCTAAAGCCTGCATATTAAGCTCCAGAGACCGC
AGCCCGCGACTGTATCGCCACGATCGCACCTTCGGTGGCAAGTAGAGGAGACCCAGTCGTTGCACTAACTTGACACTGAGCTTACGGTGcagagtgctgc
tgctcggaCGATCTGATCGCGCATTATCTTCAGTGAGGTGAGCCACGAGTCTCATTACGGTGGCGAAATAAATGCGACTGGCCTCAATGTGTTGTTCACG
GGGAGCGTTCTTGGCAATATGCGCCAGACAGAGCATGATTCCTGTCACCTTAAACTGCAACACGCGCATATCCTTGCCTTCCGATGCAGTGATCAACTCC
CGATTCGCCCAATTGAGGAACTGCGTCAGATCGTGTTTCTCCATGTCTGGTCGACTGAGGAGTCGAGACAGACAGACTGCCGCAGCGACCTGAGTTGCCC
CCGGATCGCTCAGATAGTCCTTGCAGAGAGTGACAATGTTGGACACGATGGAGATCGTTCCACTAGCGCTATCCGCAGCACTAGGCGTCGACGAGTCGAT
GGTGTGGAGGTCGAACGGTACGAGACAGAGCATggacagccacagcagcagcacatagCGCGTCTCCCATGCCGAGTGGTCGGTGCGGTCTtgtgactgc
agcagctgcaacgttGGCTCAAAGTCGCTCACTTcgtgtggcagcagcttcaccactgTCTTGTAGCCGCGCACCTTGCACAAATGGTACACGATCTGGA
ACAGTTTGTGCAGTCTCGGGTCTCGATACACTTGACATGGGAACGCCATTGCTTCGTCggttgcagcagcctctAGGGCGTTTCTTCTCTCTGTCATCAC
TCGCTTGATCTCCGCAACAATTGGGTCCAGCATTTCGTGCAGATATGGGTCCAATAGATGAGATTGCTCTAGGTATTTATCCAACTatataataataata
ataataataataataataaacGTTTGTTTAAGTAAAACAAGATAGTACAATGCACATTACAAAATAGGTATACATACAATCTGCGTGACAGTGTCATGAG
CGGCTAAGAACTCGCGATCCACATCGCTAAGCGGCGTCGGGAAGCGCGTGGacacgagctgcttcagtaGTCCCCGCACTTGTTCGCGCTCCTCGAAAAA
GCGCTTCTCGCCGGAGCTCTCGGCGTCCAGCGCTGCGTCCGTCGCATC