Description :
From Genome Similarity Track
Location :
Scaffold_391:8951- 12629
Transcript NameFunction/comments
Albla_Nc14127390kinesinassociated protein putative
Albla_Nc14127400

Sequence
3678 bases(100 bases per row)
GGAAGACCTCGATCTGTACATGGAGCGGCTGTACGACGACGATGTCGAGTCCAAGCAGGATGGAGCGAGTCGGATACTCAAGCTCGCCATGTACGCGATG
AACACCGAGCAGCTGGTGGAAAACGAAGCGTTGATGGTGCGTTCGACCGTTCGACCGTTCTCCACGCAATTGTCGATAATTCCTTTGTAGGCGCTGCTTT
CCCGGGTTTTGAATGACGACTACAAGAAAAACTCGAGCCTCACTACGACGCTTTTGCGTATCTTTTGGTGCTTTTCGACGTTTGCGCAGCTGCATCCATT
GCTGGGAAACTTTTCCATCGGAGCGACAACGCTAAAGATTGTCGAGTTTGAGATCCGGCGCCATCAGCTTCGCGCGTTGGAGGAAGAAGCCTCGGCTGAA
TTGAGCAAAACTTCAGCGGAGGCTTTGGAGGTATACCAACACGAACGAAAACGCAATCGAAAGCGTCTCCGGAAACAGAATCAGCTTCTGTAATGTCCTC
GACCTCTAGCTGGGGCGCTGACTCACTCGACCCATAGCTTTGTGTGCTTTAGTCTGCTGATGAAATTGGCCGAAGACCTGCGGACAGAGCGGAAAATGGT
CAAGAAGAAAATCATCGTGTATTTGGCCAAGGTGTATTGCTTCCGGCGTCCTCCATCCTACTTGATCTAACTCAAGCGGTAGATGCTGGATCGCACATCG
GCCAATCTCGAGCTTTTGGTGCTCACATTCCTCAAGAAATTGAGCATTTTCCAGGAGAACAACGAGACAATGACGCGACTCGGAGTGCCTGAAAAACTGG
TGATGCATCTGAGCTGTAACCATGACAAGACAATACAGGTCGGTGGACTTGTTTGATCGATTTCTGGGTCTGATTGCCTTCTAGATGTCGCTCAAGCTTC
TGCACAACCTCTCCTTCGACCCGCAGCAGCGTGATGTTCTCGTGAAGAACAGCATCATCCCCAAACTGGTGACTCTCCTCAAGAAACCCCCATTCCGAGC
TTCCTCTCTGCGAATTCTGTATCATTTGAGCATGGACGATCGGTGCAAGTCGATGTTCACCTACACGGATGCACTTCCCATTGTGATGCAATTGGTGGTC
CGTCACGCTTCTACCAATTGGCATCGAGGCTTTAGGACACTAAGTAGCTTCTTGTAGATCAATTTTCCGCAACATGCGGTCGCCAAAGAGCTTGCGGCGC
TCAGTGTCAACCTGAGCCTGAACGCCCGGAACGCTGAATTCATGTGTCAGCGCGGTGGACTGGAAGCGCTGGTGAAGCGAGTCATCCGGACAAGGGATCC
TCTGCTCATCAAAGTGGTCCGAAACATTTCTCGATGGACGTATCGCCTGCAAGAAGACCTCACAGACGATAAAACGTACAAGCAAAAAGGTCTCTGGGCT
CCTCTGGTGGTCCCTTTGATCGAATTGTGCGTGAGCCACCAGGAAAAACACGAATTTCTCATCGAGATCCTTGCGATTCTCGCCAATTTGACGCCAGAAG
ATCTCGCACCCAAACTCTCTTGGGATCAGCTCTTGCTCGATCATTCCCTGGCTCCGTTCATCACCAAGCTTTTGGTCCCGGGATTCTCACAAGACGATGT
GATTCTGGAGGTTGTGCAGTGGATCTCCACGCTTTGCTTAGAGCCAAAGACGATACCGCTGCTGGTGACACCTCGATTTATCCGCATGCTTTACGCCATA
TTCCACGGGAAAGCCCAAGATCAAGAGCTCACACAGCAGCTCTTGTTCGTGTTTTACCGTCTTTTGCGGTACCCCGAGACATTCGACCAGATCATGGACA
GTCTTGACTTGATTTCCGACCTGGTAGCGCGAGCAAGTGCACCAACACTCGATCTAGAGCGCACATTTGAGCTCCTCATGGATCTCGTTGTCAACATGGA
GATGCAGAGATGCGGGAAAATCGGTCAGTACGGTGAAAGGATCCGACAATTTCGCTTTGACCTCCACAATGCTGAGTACCTGGAGATCATCAACGACTCC
ATGGAAGCCTCGACGCTCAGCCGTTGAGGCTGATGCGAAAGAGTAACGAGGAAATAAAGTTTCTTTTGCGTCACAGAATCTTTCCGGTATCGCTCTGCAG
CTGAAGCATTCCGTAGACCTTTCTCCAGTCTGTGACGCTCTTTGGACGATGTGCTGGCCAGTACAGGTTCGGCTGCAGGCTGTTGATGGAGCCTCCAGCT
GGAAGGATGAGCGCGCGATAGTGCTTCACGGGATCGATCGTGCACTTGAGCGCATGCGCTTTGTACTTATTCTTGTTCCCATACTCTGCCAATGCGTTCA
CAAACTTGGAATGCTCAAACGCCGACTCCAATACAAAGCAGCTAATGGATCCCGAGCCGTTCTTTGCGAGCTGTTCAAACTCGCCCATGCGGATCTGCTC
CATCTGAGTGAGCAAGAGTCCCTTCTCGCAGTCGACTTTGAGGAATTCCTTGATGAAAGGCGCTTTGTGCTCGAGACACCATGTGCCATACAGCCGGAAT
TCCTGGTACGAATCGAGATTCCCGGAATCACGGAGTCGTAACACGCAAGAAAAGTCGGAGCGGTGATTCGTGTCGGCTTCCATGTCGCGACTTCCAGTCA
GTAGTGTGCTATCCGTCGCCTCGCTTTTGGTGGGATTCATCGATTTCGAGCTCATTGCGACGTCCACCAAATTGATAAAAAACTTTTCCGCTTCAGAGAG
CACGGCATACCTTCCGGCATTCTCATCGTCCGCATCGATTCGCGCGATAATGTGAGCGTCAATAGCAAGCACACATACCACATGTGTGAGGCATTTCCGA
CTGGAAAATGCGGTCGGAAAAGGCTCTTCGAATCGGATGTCAAATCGCGCAATATTGGCCAGAACAAGAGCATTGATTGACTCCATCGTGTTAGCGGTAC
TCAACACCCGAAGCTGGAAGAAGTGAAGTAGTTGAGCCCACACCGCATGCGTCTGTGTAAGCTTCTCCAGGATCCCATCGATTGCTAGATCGCAAGCCAT
CCGTTTGGAGCTGTGTGATGCGACAAATTGGATCGTGTCATTGACTGAGATGTAGACGTCAATGACACCTTCCTGCAGCCTTTCCATACGCATACAAGCC
TTCACATTCGGGCAAATCACGCGCTCAGCAGCTCCTTGGAACGACAGAGAACCTCGTAATCCATCGACAATCTCAAACAATTTATTTTTGCAGCTGAATA
AACATCGCAATAGCGCGCGGAAGCGAGCGCATTCCAATGGTTTGGCTTCAGAACTCACATCGTAGACATCTTGGGGTGTAGTCTGCGTCATGGAGATGTC
TTCCATTGCGTCCTTGTGCTCGCTCTTTACCACAACATTTGCGGTGGAAGGCTTATACGCCGAGAGCCATTCGGTATCCGATCCGGAATTCGAGTCGTAA
TCGTCTTCATCATCTTCATCCTCGTCATCGCTGCACACGATCACCTTTGGCTTGGATCTTTGACTCACTGGAGCTGCCCTTTTCGGCACCAAACGTTCCT
CTCTCTTTACGTGTGCGATCTTACTTTCTTCGAGGGTCTTGATGCTCTCCAAGAAATCGCGATACTGCTCACTAGCGGCTCGTTTCGCTTCTTTCGCGTT
CGGACATGACGCACGGATCATCAGAAAATCACTCACAAAGATTTTGTACGAGTACAAGTGTCCAGCTCGGCTCTCTGC