Description :
From Genome Similarity Track
Location :
Scaffold_144:89507- 91174
Transcript NameFunction/comments
g18458.t1XP_009514115.1 phospholipase D-like protein [Phytophthora sojae

Sequence
1667 bases(100 bases per row)
CCCTTCATTCCTGCTTCTGCCGTCTCGAGCTCAAGTGTCCTGCTTCTCCTCCTCACTCAGCCATGGACGGACTCAGCCGCGCGTTCCACTTCATCGTGGA
CCCGTTCCAGAAGGAGCACAAGCCCGAGAAGGCGGCCACCGCGCCCTTCGACCAGCCCTTCCTCGAGCCCTCGCGCTGGTTCCTGACCCGGGAGGAGCTG
AGCACGTCGCGCGACGGCTACGAGCGCAGCGGCATGCACGTGTACTCCAAGGGCAACCGCGTCAAGCTGTACGCCGCGTCCGCCGGCTACTTCAATGACG
TGGCCGACGACATGCTGGACGTGCGCCGCGGCGACCTCGTGTACCTCACGGGCTGGGGCACATGCAACGTGCCGTTCAAGCCCCACGAGCCCGACACGAA
GCTCTGCGACCTGGCGGAGGCCGCCGTGAAGCGCGGCGCCGACTGGCGCATGCTCGTGTGGTCCAACGTCACGGAGCGTGCGCAGAACCACGAGGTGCGC
GACCTCATCAACGCGCTGCCGCCGCCGGAACAGTACGGACCTGCGCGCTTCGTGTACGACGACCGCCTGCCGCACGCCACGTCGTCGCACCACCAGAAGT
CGGTGATCGTGCGCAAGGGCCGCGACCTCGTGGCCTACGTGGGCGGCGTGGATCTGACCAACGACCGCTGGGACACGCTCGAGCACGACCAGGCCGAGCT
GCGTGAACGCACAGGCATCAAGTGTCTGTGGAACGGCTGGCTGGACGCCCACGCAAGGATCGAGGGCCCTGCTACCAAGGACGTGGCCTGCAACTTCCTG
GACCGATGGAACTCGGACGACAAGCCGTCGCAGGACCTCATGGACGACCTGCTTGACTTTGAGAACCCAGACTACTCGAAACTCCCGCAGATCGACGACT
GTGACACAGCCCTCGACATCCCCGAGGACGGCACTCACGCCGTGCAGTTGTGCCGCACCTTCAGCCCGGATTACGACCACTACGGCTTCGCGCCGCAGGG
CGAGCAGTCCATCTTCCACGCACGCATCAAGGCGATCCGGAACGCGCAGAACTACATCTTCATCCAGGACCAGTACTTCATTCTCGTGCCGGAGCTGCTG
GAGGCCATCATGGACATGATGCCCAGCATCGAGCGCCTTATTGTCATTGTGCAGCGCACGGTGGAGGCCGGGTACACTGGTTACGCCAAGTACCTGTACG
ACATGGTATCTCCCATCCAGAAGGCGTACCCGGACAAGTTCAAGCTGTACTCGACCAAGGAGTCCAAGGAGCTGTACATCCACAGCAAGCTGGTGATCGT
GGACGACGTGTACGTGTCCCTGGGCTCGGCCAACTGGAACCGCCGCAGCATGACGAGCGACACGGAGATCGGCATCAACATCGTGGACACGGAGCTGGTG
CAGTCTCCCGACAACATCACGGTGAACAAGCTGGCGCGCAACTTCCGTATCCAGAAGTTCATGGAGGCCACCAAGCGCACGTACGACGAGCTGGACGCCA
TGACGTTCCTGGAGGCGTGCGACGCGCTCGAGACGGCGGCGCACGACGATGGCTCCAGCCTTATCGAGCCGTACGCCGTGTCGGACAGCGCGGCCTTTGA
CTTTGTGCCGGACGCTCTGCGCCAGATCGTGGACCCGGACGTCGAGGGCGATGACTGAGCGCGCCCC