Description :
From Genome Similarity Track
Location :
Scaffold_1243:8950- 11456
Transcript NameFunction/comments
Phypl_g12871hypothetical protein PHYSODRAFT_320450

Sequence
2506 bases(100 bases per row)
GAACTCGGACCACCTTGTCACAATGGACGACGTCCGTAACCTGGTGGCGCGTGTTCGGCAATCTGGTGAGTACTGTACTGAACGAGGGCTCGTGTTGGTG
AGTCGTTGTCTAACGTTTTGTGTTGGATGCTTTTGCAGGCAGGCAGCTATCTGATGATGATGCCGTGTCTGAAACAGTCATCCAGTTCAACTTGGAGAAT
CCGAAGAACGTGTCTACCGTGAACCAAAGTGCTCGAGGTGACACTTGTGTCATCTCCGTGACTACCGCACACATGTGTGCTATGCACAGCAACTTCCCAG
AGGTGTTGCAAATGGATTGTACGCACAAAACCAGCAAAGAGTCTTCGTTGATGCGTATTGGGTTGTCCATGTATTGACCAGTTTTCCTTCTTTCGCAGAT
ACAATTACCAGTTACTGTCGATTGTTGCAATGGATCATTTTGGACATGGGCCTACTGCAGACTGACACATGGCGAAGTGTCTGGACCACTTTAAGCGAGC
CAACGAACAATGACGGTTTGTTCGCATCGTTGTCGTCGATAAGGACATGCGAGAAGTGGATGTAATTAAGCGAAAGTTGCCGGAGGCGCGTGTGTTCCTG
TGCCACTTTCACGTGATCAAATGGCTACACGAAGTTGTTCGTAACGGGAAGTATGGGTCGTACTCGGCCGATGTAGTGACTCAGCTGAAACATGTCATAA
CTAACATGATATATGCGAGGACGGACGCTAGTTACAAGCTGAATCGAGACGAGTTCAAGAGCTTGGCGTGTCGAGATGCGAACGACACTCTTTGGGACTA
TTTCGTGACGAACTGGGAGTCGTGCGCTGAAATGTGGGTGATGGCGTGTCGTTGTGATCATTCCCCACTTCAACAATCACACGAACAATCGTGTCGAGAG
TTTTTTTTAGGGAAAGTGTAGCAGAGCATTAAGTCCCATTTCACGATGCACGACACACTGGCGGCGCTTTTGGCGATGCAGCGGCGGATCGAGGACGACT
ACAAAGCACAAGTCAAGATACCAGGGACTTTGCGCGACTCCAGGTATTTGGAGGAGATGAATGTCGTATTGGGGATGACAACACGTTGGGTTGCGTCGGC
TATCGAGACCCAGTACAAGGTTGCAGTGGCCGAAGAGAGTATGGGTCGGTGTACACTCACTGACAACGGAGACACAGAAACGGTGCGCAATGACCAGCAC
GAGTGCTTGGTCCAGAAAGCAGACTGGACGTGTGACTGTGAATTTGTGTTGACGATGAAGCGTCCATGTCGACACGCTATGCTGTACAAGAAGTCGATTG
GCAGTGCATTCGTCATTCCGTTCGCAGCCATCCCACCAAGGTATGTCCAGGTATTTTCCAGGTATTGACCAGGTTTCTTACAGGTATGTGTCATGTGTTG
TATTCACACAGATGGTACGGACAGAACCGAAGTTCTGTGGAGCacgtcacggagctggcaaCACCGTTTGTTGCTAAAGTGTACAAGACCGATACTCGCA
CCACACCTGGTCCGCTAACCGAACGGGAAAAGTACAGACGGGCTCAACAAGCCTTTGGCCGTATCAGTAGCGAGCTGACTCACTTTTCGAACGAAGCGTT
TGAAAGCGCGATGACTCGTTTTGACGAGTGGTGGCATAGTATGCGCCATGGCAAGATAGCCGCTGTCCCGGTTGCCAcggtcgacagcagcacgcaacAG
GACACAAATGGTGGCGATAAGGACGATGCTAATTATGTTGAAGCGAGCTAGCGGTAGATCGCAgagtggtggtggtggtaaTGAAGAGGGCTCGAACCAG
ACCAACGAAAGCAGACATGATGGACAAGATGAGGAATCCGACGAGCAACCCACGCAAGTAGCGCTGGTGCATTCTACAGACGTAGAGGTCGCGATCCGTC
TGAATGGATCTGCGCCTAAAGTAGGTAGACCACGTCTGAACCGCGCTGAGCAGCGGCAAAAAGCAAAGGTTGCGTTGCAGTCGTACAACCGATGAATGCG
TCTACGGGGCCTACTCCGAGACAAAGACGTCTGTGAAGTGGTAGCATGCCTGGAGGAAATGTACCCCTCATTACACGAGGTACAATCGTACATTTCGACc
caccaagttgaagcacCCAAAGGCACGCCATGTTTCACGTCGGAAATGGAGAAAAGCTTCGTCCCCGAAACGGTGCCGTTCCGATTATCGGAAGACTTCG
TTGGTGAGGTACTAGAACGACTTGAACAAGACAAGGCAACAATGAATGACGGACAGCCCATTCCTGAAACAATTGCAGTGGATGGTGATGACAGTGATGA
CATCCCAGTTGTAGTGATCCAGAAGATCGGCAAATTTAGTCGAGAGCAGTTGGAGGCTATAAAATGGCTATGACAACTACGAAAGATCTGTTCGGAAAGT
GTGAAGTGCAGCTCTTGGATACTTACCAAGGTGAAAGCGATGGTGGACAACTACGCAGCGGTTGGACGTGCGGCAgaggagctcgtgacggCATGGCCGT
ACAGCA