Description :
From Genome Similarity Track
Location :
Scaffold_141:895- 7325
Transcript NameFunction/comments
Phyke_g4960hypothetical protein PHYSODRAFT_485789
Phyke_g4961hypothetical protein PHYSODRAFT_426370
Phyke_g4962hypothetical protein

Sequence
6430 bases(100 bases per row)
ATGTTTTGTGATTCTCTCGTTTGTTGTCCAGGTTCTTGCGGGCGTAGTACAACGGCTCTCCTCCAAGGCTCTCGTTGGTGCTCCACTCCTGCTCGTCATA
ATCGGAtccagcaacatcttcgtcTGCATCCGCAGTACTGGATTCTGGCTGAAGCCATGCTCGGACGTCGTTGAGGGAGATTcagcgcttcttcttctct
gtaAGCGAGACGAAGATAATCCTCAGGCCTTCCGAGGGCAGCTCAGCTGTTGAGACAGTTAACACCATGGTAAGTCGAAGGTGAGAATGGCTTCATTACT
AGCAGAAAAACCTGTGAGCTCTTGATGCACAGTATCTTGAGTTCCTTGCTCGAGTTGATGGCGTTCTTGGATGGCTTGTTGGTCGGAATGACGATGGTGA
GGTAGTAACTTTGTAGGCGCAAAAGTTGAAGTGAGGCACTGTGAATGTGGGTTAACGACTTTGATGGAAACGGTTGGAAGCGATGCTTGTGTTACTGCAC
GCGTAAGTGTATGTGCAAGCTATGACGTATATTATCTATGACCTTGCGATGAACATCTTACTGTTTATGCACTAACAGATTCTAGAATGTCTTGTGTGTG
TCCTGGATCAGGATCCTTGATGGCAATCGTCTACAGCAATCGCAAGTAGCACTCGATCAGCGCGTTGATCTCTCTGGATCGAtgaagagcacgaagatgC
TTGAGAACGGCTCCCGATACGCGCGATGAGAGATCCTTCTTGGCGAGGAACGTCATCACGGCATCTTCAACCCGAGTGTCTATCATCAATACTTGGTCGC
GGTAATCCGTAGCAGAGCTGTCAAGAACAGAGTCGCCGTCCAAGAAATTTTCGTGAATACTACGAGCTGTTTGGTGTCCGATTTCTCCTGCTTGAATATC
GACGCGAACCACGTCGCACGGAGGTGAATCACAGACGCTTTCCGTCGCTTGGGGGGGGCTAGAgtgttgatcttcttcgtgttgacGCTtggtttgtttt
tcttggttTGGTGTCTTGCTCAGTTTAATTTCTAGCACATCCATGCGCTCATCATGGCGTTTCACATGTTGGATAAATGCATCAATCACActgcgttggt
gctggatgatcttGTAGTCTTAGTCTTTCAGGCCTTGGTCACAGTTTCGCTTGgtattgttgttgtgcttACTGGCTTCCGGGACGGCAATGAGATGTGT
TGACCATGCAAACGGCTCGGTAACGAAGTAACCCGCGCGCAGTACACAAGACTCCACACTTTGGACTGTCCGAATcgagctccttcagcatgGGTAAGTG
GCGAATCAAGTATCATGTTAAGATATCCAAGACACGCTGGCTGATGTTGTGCTTCAGGTGTGTTAGCTTGTTACACGTCGTGAACAAGAGGTGCTGAATA
CTGGCGATTGTTTCCTGAGTCTGGGTGTCGAACGAGGTCAAGTCCAGTATCTCCATGCTGTTCGAAGCCTCGTAACCACTGAGCGTCTTGCTAACCTTGT
GATCTTCCTGGTTTGTATTGAAGATGCAATTGAACCCCTTGTTGGTCGTACTCATGTTCCAGGAACCCCGGTCGAAAATCCAGTGATCGGTGGAGTGAGC
GTATCCATTGGCGTGCTGCGCGCCACCACGGCGAAAAGAGTGTGACGTGAGACGCTCAGTTACCCCATCCTTCTTCGCAATCCGCTCAAGAACACGGTTG
ACGTAACTGTGAACACCAGGCGTGGCCATTGGGGCATTGGCAGTCGAGGTGTCGGGCGCAGATTGTACCAGTGACATTGTTTCTGGATGATTTAGCAGGT
CAATTAGCGGGAAGGATGGTGTGAGCGTGGTGGATGTAAGTAGTTGCTGATCCAGAAGATAGCTCAGTAGAGCAGGCATCAGTGACGACTGGGTGATCAA
TGCGAGCGCAATAGCAAGTATCGGACAGGTTGCAAAGTCGTCGTCAGAGAAAAGAGAGAATCCTTGCTCTTCGGCCATCTTGATCCGGATGAATCTTACA
AAGAAGATGTCGCCTGAGCCGATGGATAGGTTAGACTTACGAAGCAGTGTTAAATCTGACGCTCGGCCAAAAAGGAACCAAAGCAGGCATAGTAGCGCCG
CATCTTGATAATCAGTCGTTGTGGAAGCAGTAGAATACAAATGCATGACCATTTGCTTGAGCGCCTTCTTTGTACATGCTGGGGCTTTATTGACAAAGTC
TCCAGACTCGCGCTTCAAGTAGTATCGCTCTAGTGTCTGACCCTTCTTGAGCAGATGCGCATCGACAGCGgcatgatgctgcagaaactgaCCCAGAAGT
CAGTTCTTCGCCTGGCGGAAGTACTGCATGACCGAGTGGCGCGCTAGCAGCTTCCCTTTGTGATCCTCCTTGAACACCAGATGCATGCCAAACTTGTCCA
CTACCGCTTCCAAGATAAGTGGAGAATTTTTACGCAGCATGCACATTTTTAGATACTCCCAGctcacgtcttcttcttctaagAACTTCATGAAAGAGCG
CGCCGCGCTGTCACGAGTATGCTTCGTGTTGACAGTAGCGAGGTCGTCGAGGCTCATCTTGCGGGTCGGAGGATTGTCGGTAGTTGTGAATTATACGCAA
AATATACGAATGACTGCTATTTTGTAAAGGCATACCAATAActttgctgtctccaacCCGATATGTCGGAGTGGCAGCACGTATTTGACTCTCtttgtga
ttggctgaaacgCAGGATAAATGCTTTCTGATTCGCTAAAAATCGAATCAACACTTCCTATTGGCTGAACCTCACAATAGTGAATTTAAGTAAGGTCGGA
GaagtgatgatattcatccatagGGAACGCTGATGGGTCAGCCTTACAAACTTCCGGTCGCTTGCGTTTTCCGGTATGAGTGAGGGCAGGATCAAAACTT
TGAATGAAGTTTGGCACATATTTGCATTCCTGGCAGTAAAAAATAAAAGTTGTAATCTCGCCAAAGCAAGGGATAGTTTGATGGATTACGAAGATCGGTT
GGCTGCAATACCCACTCGAAATGACTGAGAGAAGTGTCATCCTGAACTCGGCCACGGTTGAATTATAGGGCTGGTATTGGCGCGAAAATTCACTTATTTT
GTAGTTTATTAAAAACACTGGATAACCCAAAAGCTAGATTGATGTCGTGGCCTTAGATCGACGAGAACGGATAGGCCCTTTCGAGCTTTTCCTGGAAGTT
CCCATCATTCATCAGTACATTAGCGCTGCCAAAGCTCACCGTGTTTAGTGAGGTAGGGGCGGTGAATCGAAATCGCTCAGGGTGTATAGTGCGAGCCCAG
ATACCTTTAGGCGAAGCGGACTCTCCACATAGCAGCCACTCGGGAGAACCCAAAACCCGCGAAAGTCCTGGTTGGCGTGTGCTCTTTGTGTCAATCCCAT
TAAGGCCCGTTTGCCTTTGCGCGTTCCACCTACCTGTTTCGGAGTGTTGATATAGGCTGAGTGCTGACTCATCCGCCATCGGCAACAACTTAGCCCATGC
ACTCGTCAACACTCCAAAGCAAATTGCAGGACGGCACGCAattgatcttctccagtgttgaagctgtcggcACCGACGTACACTACACTACAACCCGAGG
GGGAGACCCCGTAGGCTTGAGGCCACCGTCCGTGCTACCCGCAGCGTCCACAGCCGGATAGGGATGACAGCCATTGTTAATGAAATGCGTAGGTTGGTAG
ATACCTTCGGCCACGTTCGTGATGGAGGTGGGCTAGGACATCGGGAAGGGGGCCACTTGGTCGTGGTCGATCACAGCAGCATGGGAGACTGCGAGTGaga
cagcgacagcgagtCCACAGAGTTTCATCGCAACTGAGATAGGGAGCTAATTCTGAAATAAACGAGTGTGTCGGACCTTCGTGCAGGTCACGCTGTTCTG
AGTGACtgtggacgccaagaagatgatgattaAGACGTTGTTGATCATCGAGAAGTGTTATCACCAATTATCTTTTTGATGAGGACTGTGCTATCGTTAC
CAGTGTGGCTAGTGTTGTCAGTGACTAGCCGATGAGCTGAGCTTGGCAAGTTACAATCTAACGCACATTCCGTTCGACCATCGGACCCTGACGGCATTGC
CGATGCAAAAACAGGTTCCGGCAGCAGTAATTGCTCATCGAAATGCTGGGCCGAGTATGCCCAGATATCAGTTGGCAGTGCAGGATTGCTAAAGTGAGTC
TCTCCGgatgctgttgcttcgtGAAATGCCCCAGTGGCAGCGCACAAGAGAACTAGTCGTAGTGGTGCTGAAAGAGAGGTTGTGCGTGCGTTTTACATTG
CGTGTTTGAACACGAACACAAGCATTATTTTTCTGTTGACTCGACTTGCTCTAGCACTGTTAGTCCGCCGTTATATAAAAGGGTACAATATGTTCATGGG
CCAGCATTCATTTAATGGGGTCGTTTTTATAAAAGACACCCATTTTTGCCATGTCATCGCCGCCACAGATGAGCTTCTACCGCGATGCTCCGCAGCGACG
TGTGTCTTTAGACGAATTCGAGGAGATAGGGCTCAAGCGTGTGAAGCTTCTCAGCCAAATCTTCCCACAATGGGGCGTACTGTCTTCTCACAAACCACCA
AAAGACATGTTAACAGAGGTCACTTTCTCTAAAGACACTGATCTCTTGTCCCATTACGTCCTTCGACTCGCATTCTGCAGGTAAATAACGCGCAATTTAT
TGCGTACAATTTCAATAATTTATACCTAACTATACGCCTTATGTGTATACTCTCTTTTGTGCAAGGAGTACAGAGTCTCAAGCGACTGGAACTGGCTGGT
GGCAGCTGAAGCCAAGCTCTTAGCCTGTCGACTTGGGTCACTACCACCTTATGCTGCGGTAGCTTTATTAGCAGCTGAAGGGATCAAGTATGAACTTCTG
GAAGCAGAGAAGACAAAACAACTATTTAATTGGGACCAGACATTTCAGAAGGACACGATGCAGCGGAGTATTTATCAAGTGCCTTTTACTCAAGTGCCAA
CGTTGGTGAGAAGACGAGGTGTGATTATCTGTAGAGGGTATTGTTTGGTACCACTGCAAGATATGGGTCATGTGGCTGTGCACCATTTTAAATGCGCTTT
GGAGCACCAAATGAGGAACTTACAGTGTGCAATACCTGCCCAAGGCCCCGAATTGGAGCGGTTAATACCGATACTGAACACCTTTGTTGAGAAGGCGAAT
GCTCAGGCTGGTGCTGGGAGAACGACGCAAGATCGGTTTCGATTGAAAGTGGCAGAGATCGACCGAGTAGCGTATAAACACTTCCCGTTGTGcatgcagc
aattgcacCGCAAAATGCGTGAGAATCACCACCTCAAGTACAACGGTCGGGTGCAGTATCGGATGTTCCTCAAAGGTGCGGGGATTTCAGTCCACGATTG
CATCCAGTTTTTCCGCGATGAGTTTATTAAGAAGATCCCGCCCGCCAAGTTCGACAAAGAGTATACTTACCACATTCGCCATAGCTTCGGGCTTGAAGGT
TCCAGAAAAGACTACACGCCATTTGACTGCAACCAAATCATTACTGGTGGCGCTCCTAGCCCTGGACAGTATCATGGTTGTCCATTTAAGCATTGGGGCC
GGTCAGCTttgcaggaagagctgcgtcgACAGGGTTTATCGTTGCAAACTGCGATGGAGATCACCCAACATGCAGCTACTGGTCAGTGCCAACAAGCGTG
TAAAGTGTTTTTCGAGGCGTCGCACCCGTCGACGTCGCCATACGCGCAATTGGCTGCCAACCGCATGCATTCCCACAACCAAAATGCATCTGCAGGATCG
GAGGATGGCCTTGGAGCGACCATAGTGATGCACCCGAACGTATATTTCGACGCGAGTATGTTAGCCACCGCGGATCCTTTGTGAGACTAGTACGTTGGTT
TTTAAACTCTCCTGCTCAACTTTGATCAGCTGCAACCATCTTGTCAGCGTAACGTTGAGCATATTTTTGGTGAGTTCTAattgaagctcttcttgcaatT
GACCTCGAGCTTCGCTACAAACGACTTCCCTATCTTTTCGGATTGATTATTGCCTCGCTACTGCAAGACATCACCATGGACGAagaacagaagcagcagg
ttaTTCGGCATCATCTTTAACTTTAACGCAAAATACTGTAACGAAGCTGAAGTTAtttgctggttttgctgtgtttgACGATGTAGTTGCGCGATGACCT
GCAGTTTGCCATCATGAAGGCGGAACAGCTCACAGTGCTGGACTCGAAGGCTCCTGGAGGGTCGACAAACAATCCGATGGATATTAAGTCGCTGGTTGAT
GTCTTCGCTGTGTTTGGCTTTACGGCGGAAGACATTATCGACAGACATGACCAGTGCACGATTTTCAAGAAAATTCGTACAGAGCTAGATAAACTCCTCC
GTGAACTAGCAACAGGTACTAAGAAATACG