Description :
From Genome Similarity Track
Location :
Scaffold_854:895- 4166
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh-pug3_contig_854-abinit-gene-0.21Kinesin heavy chain

Sequence
3271 bases(100 bases per row)
AAGCAGCATGACGGTAGACGGGGCAAAGGCGGGTATCCGCGTGTGTGCGCGCTTCCGGCCGCAGAACAAGCTCGAGGTGAAGCAGCAGGCGGTCGAATGC
GTGCGCGTGGACGACGGCAACACGCGCGTGCAGATCGAGCACTTGGGGCGCTCGGGCGAGGCGCTGACGTTCACATTCGACCAGGTGTTCGGGACCAAGT
CGACGCAGGCCGAGGTGTACGCGGCGACGGCCAAACCGCTCGTCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCGTGTACGGCCAGACGGGTACAGGCAAGACATTCTCGATGGAGGGCGTGCCGGGCGACGCTGAGTACGCCGGCATCATCCCGCGCGTCATGGACGA
CATCTTCGACGGCATCCAGAACATGCAGGNNNNNNNNNNNNNNNTCGTGCGCGTGTCGTATATTGAGATCTACTTGGAGAAGATCCGCGATCTGCTGGAG
CCAAGTTCCAACAACCTGAGCGTCCGCGAGAGCCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGCAGCCACTCGGT
ATTCATCATCACGATCGAGCAACGCAACGTTGCGACGGGCTCGACACGCAGCGNNNNNNNNNNCCTCGTCGATCTTGCGGGTTCTGAAAAAGTCGGCAAG
ACCCACGCCAAGGGCCAGACGCTCAAGGAGGCGCAGCACATCAACAAGTCGCTGAGTGCGCTGGGAAGTGTCATGAACGCGCTCACGAGCGGCGCGCAGT
CGANNNNNNNNNNNNNNNNNNNNNNNACCGCGACTCCAAGTTGACGCGCTTGCTGCAGGATTCACTCGGTGGTAACTCCGAGACGACGTTGCTGGTTTGC
GGGAGCTGCAGCAGCTACAACAGCGAAGAAACGATCTCGACGCTGCGGTTCGGCACGCGCGCCAAGAACATCAAGAACAAACCCAAGGTGAACGAAGAGA
AGACTGTGGCCGAGTACAAGGTGCTTGTGGCCGAAAAGGACAAGCAGATCGCTGCCCTGGAAGCCCAGCTTCAGCAGCTTGCGGCAAGTACAGAAGGAGC
TGCTACTACTCCCACTGCTCCGACAATAGAAGACGCAGAGAAAATGCAGAAGTTGCTCGACAAGATTGAACAACTAGAGGACGAGCAGGCGACCAAGGCT
GTCGAGATCGCTACTTTGGAAGAGCGCTGCAGTGAGTTAGAAGCGGCATCCAAAGCTACGGAGCGCAAGGAGATCGAGATGGCGTCGACAAAAAACCAGA
ACGACGAGTTTGTGCACAAGATCGCGTTCCTGGAGAGCGAACTCGCTGTAAAAACGAAAGAGTGTGAGGATCTCAGCACGATGCTTGAGAAGCGCCGAGC
CAAGGAGCCAAGCGCTGCTGCTGATAAAGCGTCAGATGCAACGACTTCGTCATCAATACCTGCAACAATCGCAGAAGATAGTGCGGTTTCTGTGCCAGAG
AATTCTCAACAAGACGATGCTGCTGTAAATGAACAGTCAGTCGTCGACCGCCGTCGTGCAGACAGCGCATTGCTCGACAATGAGCTTTTGAGACAGCAGC
TCAATGCGCGCGCGCACGAACTGAGTCTCAGCTCTAAGCGAATCGATCAACTGGCGGAAGAATTGGTCAATTGCCGCAATTTCTACGAAGACCAGGTGTT
TGCACTGCAGGAGAGACTGCGCGAGTATGCCGACCACGTGCGTGCTTTAATGGAGGTCTCGGAGAATGAAGACAAGACGAAGACAAGCCAGCAGCTTGAC
AATTTGCTGCACCATGCCAAGACGTTGCGCGCTGTTCGAGGAGGTGGTGGTGTCGCAGCTCATGAAAAACCACCAGCAATCCCAGAAGACGTTGCGCCGA
CAGCGCCACCGCTTCAGCAACGCGCGCGCATCGTGAGTTCGGCGAATTCGCCGGACGGATGGCTTGTGGACGACGAGATCTTCCCCATTGCACCCATCGA
CATGGAGTCTCCAGTGGTAAAGCGGTTGATTGCGAGTATGCCTGAGAAAGGTCGCGAGAAGCTGTCCAAGTGGCTCGTATTCGTGCTTGAAGGTCGCGAC
ATTCGTTCCAACTTCCACCCAGAGATCTCTGTTGAAGGCATTAACGAAAACCTCAATCGTGACATGCGCAAGCTGATCGTGCCACTACTGAAGAACCGTC
GCGATCTCAACGTCCAGTCGTTCGTGCGCACGCGGTTTGTGCGCGTCACGGATCTCAAGATCACACTGGTCCACAAACACCAAGACACGGTCCACGTGGA
CGCTGCGGACGAAGGAGACGACGGCGACCATGACGGAGCAGACGCAGGCAAGATGCGATCGGGCTCCAACGCTCCAGCGGCTGGAAAAACAGTCTGGGCC
AGAGACCACGTGTTTTACGGTCCAAAGAGCGATCCGTCGAGTCCGTCGGTGCTGCATGGGGAACGCGTGCTTTTGCCGTCAAAGGACCGCTTCACGTCGG
AACCTGTGGACCTGAGCGCGAGTGTGTCCGATTCAAAGACGATGCTGGACGTGAACCCACCGTCGTCGTCCAGTTCGACTGCACCTTCGTCTTCATCGGG
CGCGCCAAGTTCAGGTGGAGTGTTTGGTCGACTGCGCTCCAAGACGAACGTCGGTGCCATGTTTGGTGACGTGAAGAACATCATCTCGGCGCGGTACCAC
AAGCACCACGTCCACGAAGACACACTCTGCGATGGCTGCGGTATGAGTCCGATCGTTGGCGGACGCTGGAAATGCAACACGTGCGAGAACTTTGAGCTCT
GCGACAATTGCTACGGCGGAGGCGTCCACGGGTACGAAGTGAGCAACGAGATGTGCCGCCGCATCGAGCACGCCGCGGTGCACAAGCATCGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTCTTTGAGCTGTTCCGGCGTCACATTTGCCACGACGATGTAATCCAATTCCGGCGCGTTGTCGATTGGCTCGTCGAC
ATGGTCTCGGNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCAAGATCATTGTCAAGACAGGACTGCATCCTGAGATCCGCGCTCGTCTCGTCGCGCAGCTC
GGTGCTCTAGCGAGCGAACGACCAGACATTGTGCTGAAAACGGAGTGGTTTGTCGAGAAGACCACCGAGGA