Description :
From Genome Similarity Track
Location :
Scaffold_272:895- 21822
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_272-fgenesh-gene-0.1Regulator of chromosome condensation (RCC1)
Pytiw_DAOMBR242034maker-piw_contig_272-snap-gene-0.5Regulator of chromosome condensation (RCC1)

Sequence
20927 bases(100 bases per row)
GCCCCCACACAAAGCGCAGGAACGACGACTTCTGCTCGTCCGAGAACTCACCCAACACGTCCCAGAAGAACGCCACATGCGGGTCCGCGGCCTGACAGCC
GTCGCCGTAGATCGTGCGGCGGCGCAACAAGTCGACGTCCACGGTCGCCTTCCCGCACACGAGCGTCAGGAACTCGCGCCACGTGAACAGCTTGAGTGTT
GGTGCTGGTAGGATCGTCGCCAAGCCTCGTGCAATGTCGTCACACACGGCTCTGAATTCGTTGATCCGGTACACCTCGACAGCGCGTGCGTACGCCTCCT
TGTCCTCCCAGGTCACGCGCACGTGCTTGCCGCCAGGGACGAGCTCCACTTCCTCTTGCGCACTGGACAACACTGTGAACGTCGCGTCAATGATCTCGTC
AAACATGCCCTCGGAGATCCCGTGCGCATCGATGTGGTAGATCGTGTCGACGACCTGGAAGCAACCCTGGTGAATGCTCTCAATGTCTCGACGCGCCACA
GGTTCGTGCACGAGCGCCTTCCAGAACACAGAGGGAAGATTCAAGTCCAGTGGCGTCTTGGTGCGGATAGCAATTCCCACGAGCTTGCCGAGGAACTCGG
CCATCTGCACCAGACGCGGGTCACTACGCAGGTGCACGTTTGGCACAAATACTTCACGGTTCTCGCCTACGCCGCTGATCGCGTTCGGACACGGCTTGAA
CAGCGGCAGCGTCTTGGACTGGAGTTCCGAACTGATCTGCGCGAGACACTCGCGGTACAACCCGCCAAAGTCGTCACCGAATTCGCCCACGAACTGGCAC
TTGAACGACCGATCCGCGCCTCGCAGCAGCGATGGCTGGATCGCGTGCAGCTGTTCAAACACTTGCGCAAAGACGCTCTCTCTATCGCCCGTCAAGAGCT
CTGCGGCTTCTCGTGCACGGTGACGGTCGACCTCAATCTCAGGCCGCGCCGCTGCGGGGCTCTGTTGCTCCTTGAGGACGCTGAGCCACCACGCGAGCTT
CACATGCTGGAAGATTACGCCACGCAGCACACGCGCGCCCTTCGCGAGTAGCGAGTGGGCGTCGTCGACGGAGAAATCGATGAACGAGAGCGAATTCTGC
AGCCGACAGTTGAAATTGCGCAGGATCAAGAAGCGCTTCTGCAGCTGCGCGAGCGTCAGCGCACGCAGGCACGGACACTTTCGCAGGTGCTCCTCCGTGG
GTACAAACTCCTCGGGGGACATGCGAAGTGGGTCGCAGCTCAGCAGTGCCTCGGCGCGGGCCTCGCAGATCTCGTTCACGATCTGCACTAGGGCCTCGTC
GTGCTCCAAGGTGAACACTAACTGCGAGTCGTGGAGCTCCTTGAGCTTCTTGCTGTACTTGGTCGCCAGCAACCGGCGTCCGGTCACTGAGAACTCAGGC
ACTGCAGTGAACGCGATCCCCCACTTATCGACATTCTGCGCTGCATTCAGCAGATCACCACCATCCGGCGAGATCTCATCGTCGCCCGCAAGCGTCGATA
CAATTTGGCCATCCGCGACATCGACAGTCGTCTCCAGCGCAATCGATTGCTCGCTCAGGATTTCTCGGTGGCGCGCGTGGCGACTCAACGCTTCGGCCTC
TTCGCGAACAAGCGCGTCCATGACGTGCATGTTTGCGAGGATGAAGTCGGCGGCCTGCTCTGCGTCGTCGTCGCAGTGCTTGAGAGAATACACACACCAC
TCCATGGGGAAACCCATCTGACTGAGTGCCGTTGCGAGCTCCATGCGGAAGTTCGGGATGCCTTCGTCAACGTCGCCGATTGCCTCGCTCTCGTCCTCAC
TGTAGTAGACTTCGTCGCCTCCAGCACCAACGAGCCCACTAGCTGCCAAGTGAGTCGCGTCACCACCTCCATCTTCGACGCGATGGCCTCCAATCAAGTC
GATTGAATCACGCTGGTTGTACAACGCGAAGCCCGGGTAGAACGTCCCTTCGAGCTTTGGCCCAGTGCCTCCTGGACCAAACGCGACGCCCAGGTCCTTC
CCGTTGAGAGCGTAGGACAGCGTCCCACGCTTTAGATCCAGCGTCATCTTGACAATGTCACCAGTCTTGAACTTCTCGCCGTAAGTCCCGCGCTGCTTGC
TCCCGTTGTGCCACAGCGCACGGTTGCCGATCCAGCCCCAGCCGCGGTTGTCCTTGCCCAGGTACGAATCCAAACGCACGTCCTTGCGAGCGATGCCCAA
AAATATGTTGGAGCTCGCAGTCACAAACGAGATGCGAACCTCCCAGATGTGCACGCCGCTGTCGAATCTCGCGACGCCTATCGCAGTCTGCCAGCCCTTG
TCTCTCGTAAGTGAGAGTCGCGTGTCTCGGTTCTCGAGCTTCAAGTACGGCCCCTTCCGCACGCGGTCCACGCGACACTGGAAGTTCGACTGCACTGGGA
AGCGCCACACAAAGCTGTCGCCCTCGATCATGACTTCCTGGCTCCCGCAGCCACCCGTGAACGCTCGCACCTCCGACTCGCTGCTCTCGGCATTTTCACC
ACCCTGCAGGATCTGTAAGCAGTGCGAGTTTGCGGTCTCACACTGCTGGTCGAGCTTGACGCGAATCGACGTCGCCAGCGGGATGCTCACAAGCGCCTCC
TGCAGCTCGAGGTCGTACGGGTGCGTGCTCTCGACTCGGATGCACACATCTTCCGAGATCTCGGACAAGAAATTGTCGGCCGATAGCATAAACTCGTTCG
GAAGGTGCTGGACAATGGTGTTGTCACTTGGATTGTCTCGCTCCGGATCCATCAGCGAGGCCATGACACCATACACTTGACTCAAGTGCTCGTACCACTC
GAACGCGCCCATGAGATTGTCGCAGTCCATCGAGTTGAACCGGAAACTGAAGTTCGCCTTTGACGATTGGACTTCGTGGCCCACCGCATGACCAAAGTTA
ATGAGGAACTTGCAGTCCGTGTTGAGCGAAATCGTCGGATGCAGATCCTGCGGCTGATCGATGGACGAGAACGCGATGCCCAGCAGCTGTCCGTTCTTCG
TAAAGAAGACCTCGTCCGTGTCGAGTCGCAGCCCGCAGCCGAAGATGTCGCCCGTTGCGACCGCAGCGACCTGCTCGTTCCACCTCCAGTGATCTGCTGT
CAGGTCTGTGCTTTGCACCTTACCGTTCACTGGTGTGAACGAGAACGAGTGGGCACGGCCCGTGTTAAAGCCGACAGATGCCCCCTCAAGTGAGAACTCG
GGCGTCGAAAAACCAAATCCGATTGCGCCCGCAGTCGCGTTGCTCCATTCGACCACCGTGACTTCAAAGTAAACGATTTCGGCCTTGATGACGTCCTTCA
TGGTCATGACCAGTTCGGGCGTGTGCTCAAAGCGACACGAGTAGTACTCGTTAAGCGGCATGTCTGCCTGGGAAGCAGTCGGATTGGCTTCTTCTGCGTG
GTACTCGAGCAAGAACTTGCGCTCTTCTCCTGAGAAATGGCGGGTCACCGTCATCTTGGATGAGTGGCTGACCATCATCTCGACGTGGCTCGGCTCGCGT
GCAAAGTGGTACCGGTACGGCAAACTGATGGACGAGTCGGGTCCCAGGCAGGACGCGAGCTCCTCCACACACTCGCTCCGGTTCTGCTCTTCGACCACCA
ACATGAGCTCAACGAGTGCCTGCAGGAGGGAATTGAGCATAAGTCCGCCTTCTTGGTCTTGATTGAGCGCCATGATCTTCGACCGGCAGTAGAGTAGCCC
GTGCTTGTCTTTCCACTGACCTCCACTGCGGATTAGTTTGATTAGCGCACGAACTAAGTCGACAGCGAGCTGGCCGCACGACGGTGTCTTCTCTCGCAGA
ACTTGCTTCACGAGCGCGAAGAGACCTGCTGAGAGCTCGGATCGTAGTAAGTTACTATCCTGGTTTCCCGCGGTCTGAGTGGAGCACAGCGACTTTTGGC
AAAGCAACAGCGTGTCCACGAACACCAGCACGTTGTTTACAGTCACTGGCGCACAGAGGATCTTGTCTTCCTCCGACAAGCTGAGCGCGAATGCGATGCT
GGGCTCCGTGTTTTCGATATCGTTGAGCGTGATGACGGGGAGCACGCCACCACAGAAGTCTGAGTTGATCGACCACAGCGACGTCTGGACAACAATGTCG
TCGGGATCGCTCACGCCATTGTCGGACTGGTTCTTCGTGTTGAAAAAGCCGGGCTCTTCGCCAGCAGCTTTGCCGATAGCTGCTTCATTCGTGTTGGCCT
CGGCTCTCCAGACGCACCGGAAGGAGTTGACGCGCTTGACGAGATCTTCGCGAACGCATCGAGCGCTTGCAACAGTCGGGGGTTCGAATGGATCTTCCTT
GCTGCCAGCAACGCAACCCATCGAGACGTACCCCGGCGGTGCAATGGGCCACCAGATGGAGCGAAGCTGCTTGCGCTGGAAATCGTCATCGCTCTCCATG
TTTCTCGGAAGTCCCTTTCCCGTGACATCGACTCGCTCAAAACCGACAGGAGGGAGCAATAGACCGTTACCTTGATCGCTGACAAGGATGATAGGACTCT
CTGGGGTATCAGAACCGCAGCTGATCACGTCTCCGAGACTGAACCAGGTCTCAGTGGCACGCATGTTGCTTGCGGTGGGCACAGTCGGTCGCCAGATCGT
CACTTGGTGGTCGCTCGACGCTCTCAGCCAAGATTCAGGTTGTCGACTTCCGGCTGCAGAGCCATGACGACGTCTCCACTTGTGACGGTACTTGAGCAAA
GGGTCCGGAGACGGCACGCTCCACACTCGCTCATACGTGTTCACGACCAAGCACTCGAGGCCTCCAGAGAGGTTGAACGGACCCTTCGGGAACAAACAAT
CCACCTTGCGGTTTTTCGACGCCGATGACGACGCGTCCCAGTTGAGCGAACTCGACGGAGACACGAGCGTTCGCGAGATTATGTGCATCATCGTGTCGTA
CATCAGATCTTGGAACAGCGTCAGCTGGAAGGACTCGTCTGAGTGAGCTTGTTCCATACCCGCAGCTGGGACAGTAGCAACATTGTTCTGCATCAACGCT
TGAATGACGCTTTCCACTTCTGCTGAATCTGACTTCAGCGCAATCTCATGACTGTGATCGACTGACAGTGCGAGGGTCGACAGGATGCCCACCGAGCGCA
GGTTCTTCGACATCGTGAGTGTCATCGACGAGCTCATGATCTCGTTTGCCATCCTCGACAGGATGTGCTGGACTTTGTCCTCGGCCTTGTAGGATTTCGG
TTCACTGTAGCAGAGCACCGCGCTCTTGGAATGGCCCGTGAATGCGACCAGCTGACGCAGTGTTGTCCGATCACCAATGGGACTCAGTAGGTTCTCGCCA
TCGCAAAGAGCCTGTGGAATGTAACAAGCAGTTAGCTCCTTATAGTTCAGTGACATGCAATAATTGTATCAGATTCTACACACCTTTGAGAACAGTCGCA
CGACATGGTTGAGCGCTTTTCGCGCGTGGACTGCAATCAGGAGCTGGACCAGGACCTCTTCCTCTTGCTCAACCTCGTGCCAGTTCATGCTGCGCACGCG
ATCGTCAAAGCAGCTGTTGCACTCGCTCCACATTGAGATCTCTGATTGCGTTGACTCTCCGTTTGCATCAGTTGGTTTGCCCTTGTGTGGACTCCCTCCC
GGTCGCGCGAAGCGCTGTGGGGCTTGCACGGCGCTCGAGTCTGTGAGCATATAGCTCGGATTCTCATCGATGAGCTCCTGGTAGTTGACGAGCATGTCGC
TCTGAGCTGAAGGCTCAACGCGAGCAACATCTCGCCGCTCTCGGTTCCTCGATATCAGCTGATGCTTTGGCGCAGTGCCTTGCATGGACGACTCCAGCGC
CACCCCACGGGTTGACAAAAGCAATCGGACCGCACAGCCAAAGTTGTGCTCACTCAGGTGGAGTGCTTCGGCACAGACCTCTTTGCTCTTGCCAAGAATG
AACGCTAGATGGCGAACGTTTGGCGGGAAAGTCTCGCGCGAGATGTTCGCCTAGCAAAGACAAATGGTTTTAGAAAAAAGTGGAAACTGAGGCAGTCAAA
GGCGATGATGCGTACCGTTTCTTGCGAGTAGTTCCTCTGAACGAACGTAAACGCATCGCTCAGATCGCCTTCTGTGGCTCGCAAAGCCTGATCGCACTGG
TCGTTCGTCACTCGGTATCCAGCACCTTGCAGTCGAGCGAGGAGCTCCTCTGCGCCTACCTTATCGTCCACGTCATTGCTCGAAACCTGCTCAGCAAACT
ACAAGTTATAGCAGAGTGTTAGTACTGTCCATTCGACACTTTTCCAGGAATGTACAAGTACATACAAGTGGAGGAGGTGGAGGCATCACCGCATCTCCAG
GTAGCGACAGCACGCGTGTCTTGGGGATGTCGTCCATGAAGAAGCCTTGAGCACCGTGGCGCTGGGCAGATTCTCGGTTCACGCTCTCGCGCCCAAGTGC
GATACGTAGCGCTTCACTGACTGCGCTCTCTTGCAGTCGAATTCCAGCCGGCTCCCCTGGTGAGAAGCTGTCTCTTTGCTGATACGATGCTGGCGAGAGG
ACTCCCGGAGGCATCATGTTTGGATACATACTAGCAGTTGGCGAGCCCACCGCAGGAGTCCCAGGCGCCTGGAGAACCGAGGACCGAGGGGAATTGAATC
CTCCAACGCGTGGAGAGTCAACTGCGGGGTTGGGCGAGATCAGTGCTCGCGGGACTTCGCTTTCAGCGATCGACGTGATGAGCCGCAACCCTTGAGCAGC
TGCGATGCGATTGCGAGAGACCTGAGCTCGGTTATCCAACGGATCATTCGCTCGCGACCCGCGATTCTGGATCTCAGCAGGGCTTCTTGGCTCCACCACA
CTAGGTGTGCCGTTCTGAGGCTGCTGATACTCTTGACCTGGAATCATGATGTTTAGGTCACTCGGGTTCTGCGTGGCTGTGATGATAGGAGGCGGCGCGT
GACGGCTTCCTCCACTTCCTGGCGCTCGCACGTGGAACTCGTACGTTACGAGACCACCTCGTGACAGTATCAGCGAGATCCGTGAGCCTGGCGTGACGCG
GATGCTCGTCCCATGGACGCGGACTCCGTTTACAATCGTTCCGTTCTTGCTGAAGTCCTGGAGCTCGTAGTAATCTTCGCTGGTCTCAGTCTCGCGGCGC
ACACGGCGTAGGTGAAAGTGGCGGCCGCTGACACTGCGATCATTCACGATGAGATCACACGAATCGGCTGCTCGTCCAACTCGGATGATCGGCGTCGACA
GATGGAACGGAGTGAAATCGATTCCAGAGTGGGACTCACTGGCGCCAGAAGGTCCGTTCTCGCTCTCATTCAGCTGAGGTAGTGGTTGAAGCACGCCCCA
TACACCAAACGGAAGGTCCCCTGAGACTCGGTTGTGCCCGCTTATCAGCGATCTCGTGCCCGCTGAACTTCCAGTCAGTGGAGGTCCAACTGCTTTGAAA
GCGCCAGGGAATGTCACGTTCCGACGTGGAGACTGGATTGCGTCAATGCCCCAGCTCAGAGCGTTTTCTTTCCCCAGCTTCGTGACCACTTCCTCTCGAA
TGACAGCTTCATAGTGGTCCAGCGTCGAGTCGACCACGGTTTCCGTATCCAGGCAGATCTGGCGCTGCTTGAGGCTTATCCATCTGTTCTGCAGGATGTT
GGTGGCTTCAGAGCTCTGTGTCGACTGTTTCCCGTCCATCTTGATTGACAGCAGACTGCTCGCATTCGAAAGTGCATTCTCAGACGCCAGTAGAGCCGCG
AGGTTTGCGATCAGCTGTGAATCAGAGTTCGCGAGCGATGGGGTCAGCGAAGGCATCTGGCGAAGCAGAGAAGACAGTGCCTTTGTTGAGCGCCACTGCA
ACTGCTTCTTGAAAAAGCCGAGCTTGGCTCGTAGAATCTCTTGCACCGAATTGTTCTGCGGCTGGTCGAGCTCTGAGTGGGCAGCGAACTCCTCTGCAGT
CGGGAGCACCAGGGTCGACAAGGTCGCGATGATCATCTCGAGATCGTCAAACATGCCGATTATCGCTGGCATACGTTCCCGAATCTGCAGGCTCTTCATG
GGAATAGAGACTACACAGGGCGTCGTCTCCAGCATCGCTTCGACATCGAGCTCACCGTCCTTGCTGCAGACCATCACCGACGCCATCATCTCCGAGCGCG
CGTCCTGCTTGATACCAGTAAGCAGCCCGGACTTGTTACTGCGCTTGAACTCACTGTCCTCAATGGAGACGTAGCCTCCCTCTCGAAACACTTCCGTGTG
TCCACCTACAATCCCGATTGCAGCAAAGATGGTCGTGAGTCCGTCAAGCGAGTCTTTTGCCTTTTGCCAGTACATCAGTGACTTCTTGTCTCTCGAATCG
ATCGCGCCTTCCACGTTAGTTGCCTGCTTGTCCTCTGGTGGAGTCACAGCTTCAGTCTGAGCGACTTCATCGATCTCAGGCGAGCTCGTCGATTCGGGCT
TTCGAATACTTGTGATCTCGACTGTGAGCTTGATATCTGAGCTGTCAGTAGGCACTACATTCTGCATATCGCCACAGGTTTGCGCAATGCTCAGTGTGGT
CTGGACATTGGCGTAATAGGCGCACACCGTGTCCAGCAGCTCGCCCAGCTTCTCAGCCTTGGCAAAGCCACGGTTGAGCGCCGCGTTGACTGCAACTTTC
CATGTAGGATACAGCGTCAAGTACCGAATGAGACTCAGCGCTTCCGATGCCTTGGCCGAGGCGATGTGGTTCTTCTCTAGTGTCTGCATTTGAACATCAC
CAACGTTGCACTCGCCGCCACTTACTGACACACCCTTCAAGCACTTTGCATTGTGGCAGAGCGCTGAGCTCGAGCTTTCAATACCGAGCTCGTGTGTACA
CAGTCGCGGTCGAAGCACGAGCGGGCGACCGACCAGGAGCATCAGCGAGCTCATAATGTCGCCAGAGAACGGAGGCGACGGCTTGATGCTGCGATGGATC
TTGTTGAGCGACGAGATCGAGTGGAGTGGGAAGATGAGCATCGCCAATCGGATGCAGATCGTTGCTGATGGTAAGTCCGATGAGTTCATCTCCTTGATCA
CGTGCTCCGTCACCTCAACATTGTTGGCAATGATGGCGCTCACATCACTGTCAACAGAGCCGCACTTCAGGAGCACCCAGAGCACTTGGTTCCGGTAAAA
ATGCGCGTAGAGAGCGTCCTGTGGTCCTCCTTCGCTTGCAGTCGTAGCACTAGTGGCTTTGGAGGAAAGGTGCTTGAGAACCCCAATGCAAATGTTCTTG
AGACTGATGTTCGCCTCGGTCCCACCCTCGGTCAAGCTCGAGTCAATGTCGCTGCTTGTAGTTTCAGACTGCACCAGCTTAAGATTCTCGAGCAAGAACC
CAGTGAACATCCGAAGGACTGGATTCAACGACTTCTTCGTTGCCACAAGAATAATGGATTTGCCCTTCTCTGCTGGACCGCGGTCACGTAGCGACTGGTA
CATGAGCGCGCGAGTCAGAGCCCACGAAGCGGCATGGAGCTTAATGAGTGGCAATTTTCGCTGCAAGCTGCTCCGCTTGAGCTTCATCGGCGCTCTCTTT
GCCTGAGCGTCGCTGGCGTTTTGCCGATCCATCTCTTTCATGAGCGACTCGTACAACGCTTCCGACGTAGCTAAGCAGCTGTGTTCCGGCAAGTCTTTTG
CGTGCGCCTGGTCATCTCTCGCACTCTCTGGATCACTCACGCTGGACCGACCTGTCAGAATATACGAGCTGTAGAACCCAGCTGCAATGCACACAACGTC
GTCGTTCGACAGCGAGTTGGACGGTACTGGGAGCGGTAGATCGGCGGACGGCAGCGTTCTCGCCCCCGCGCCAAGCTGTCCTTTGTTGTTTCGTCCAAAC
ACCATGACTCGTCCGTTCGCTAGCAAAATGAGCGTGTGGTAGCAACCGCAGGACGTGTACTTGATCTTGGACGAGAGCGGGAGGGGCACATACTGTGGCA
TGTTCTTGTGGTCCTTGCTACCAATGCCCAGCTGACCGTAGTCGTTTCTCCCCCACGTGATGAGCTTTCCTTTCTCCGTGATCACAACCGTGTGGTAGTA
CCCGCAGCTCACGTCGACGATCTTCTCGTCGCTGTCGCTCGTGGAGATCTTCACCAAACTCGGCACTTTGACATTGCGAGCGTGGCCGAGACCGAGTTGT
CCATAGTCGTTCTTGCCAAACGAATACACTTCCCCTCCGGCCGTCACAGCGACCGTGTGGTACAGGCCACACGCAACCTTGATGATGACTTGGCTGGAAA
TGGAATCAACCAGTTGCGGCGTATGCTGGTGCTGCGTGTGGTCGAGGCCGAGCTGACCGCAGTCATTCATCCCAAACGTCAACAACTCACCGGCGCTCGA
GACAACTGCACTGTGATGATAACTGACTGCCGCGTACGTGATGTGGTATTTCTCGCGCAGAGAGTCAATCATCCGCGGTGTGTGACTCTTGGAGATGGTC
GATCCGAGACCAAGCTGGCCTCGGTCGTTGTAGCCCCACGAGTACACTGCGCCGTCCGTGGCAACTGCCAGCATGTGTTCACACCCGTTCGCCGCTGCGA
CGAGATCGATCGAGACCCCACTGAGCGCTCGTACGGGTGTCGCCAAGATGACTCGCTCTTCAAACGTGCCGTTACCGCACTGCCCGCTCTTGTTTAGGCC
GCAGGTGAAAACTGAGCCATCTTTCATCACGACCGCGAGAACTTCATTGCCGCCAACGATGCATCGGACGCTCTTCGTGGAGAAGAACGGTACGTGCTCC
AGCTTGCTTGTCGAGTTGCAGTGTCCGAGACAGAGCTCGCCGTAGTTGTTTTGCCCGCACGAGAAGAGCTCGCAGTCGTCAAACGCTGCGACAGACGGCC
TCTCTGGCGCCCCAGATCGACTTGTCGAGGTTGTGGTGACGCCCATGTCAAAGGACGACGTCATGATGGAAGACTTCAGCTTCTTGGACGCGTCCAGAAG
AGCTGTGATTTTCTCGTACCACGGCTTTCGAGGCGCGCATAACATGGCATTTTTGTCCGAAGCGAAGCCTTCTTGGGTCTCTGAAAGCGCGGTGTAAGCA
TAATGAGAAGCGTTTAATGAGCCTCGGTTGTCGTCGTAGCACGCAGAGCACAATTTGATTGCGTCGTCGTCCTTGAGCCCATAGTAGATGCCGCACAGAG
GCGTCTTCTTGCACTCTTCGCAACTGTGCGAGCCACTCACAGCTTGCTCGTTGTACGCTGGCCCGTTCTCACGATCAAAGACCCCGCAGAAGCCGATGTA
CCCAACGTCAATGTTGGATCCTGACGACGGACACAAAAGCTTCACGAGCACATAGCGCCCTGTAACAGGACAAGCCAGCTGCTTGGAGATCTGCGCGCAG
CTTCCATCCAAGACAAAGTACGCGATCGGAAGGCTTTCATCTCTCAGCGTCCTGTCACTTGGGGGAGGAAATGGTAGCGACGCGAATTCTTCGGGGGTCA
TGTCGTCAAATGCCTGAAAGTACTCTAGATCCGGCGGGCTGCTCGTCACGAACATGAGCGCATGGCGCGCTGGACTCGAGTACCCAGGTCCAGGCCCTCG
AATGGTGACGTAGCTCAGACAAAACGGCGTGTCAACCTCGTGCTTGAGCACGAGGTTCACATTGCTGCCCTTAGTGGAGCTGAATACTGATGAATCGTCC
AGCAAGCTGTTCTTTGAGGAGTGCGACGAACTGAACTCTCCGCCATCGCACGAGTGCATGACGAGCTGGAGGCTCTTCCCGATCTGAAGCTCGTTTGATG
ATGTCAGGTTGTAATTGTGACGCTGGCCGACTGGGTGGCACGCACTTGGAGGGAGCTCGAGTCTCGTGTGTGAATGGAAATTGACGCACACCACTGCGCC
ATTGCACAGCGCCGACATGGCAGGGTAAAATGGTTTCCTCAGCAACACGGCACCAACACTGAACGTCGTGGGCTCGTTCTGGTTGGCGTAGATAGCGACG
CTCCCCTTGTCAAAGTCGAAAAGCACTCCAAAGACCCGATTTATCCCGGCCTCGTCCGCATGGCCCCACTTGACCGACGCTTTGCTTGGCAATGCGAACC
CAACACTGGTGAAATCGCTGTCGACAATGCCGAAGCCCAAGTTCACCTCTCTGTCTTTCCCGGGGCATAGCACATGGACTTCCACGAATAGCATGCCGCA
GTCAAAGGCTTGCGATCCAACAATGGTTTCGAAATGGTCGTCCGCGCCACTGGAGTCTCCAGCCACGATCGTTGTTGCGTTGGACGACAGTTGCAGGTGG
TTTCCTTTGCGTTTGCCGTCCCAACAAAGCGTCGAGCCTTCAATTGGTGCAGCAACGAGTCCACCCGACACCACGGCGGTGGAAAACTGGAATCCATTTG
CACGAGACCAGAGCTTGGGAGGAACTGAAGCGGACAGATCGAGCACGACTTCAGCTTTTTGGACTGCGATCGTCGGGAAGAAGCCAAAAGGGAAAAACTC
CTTTGAGCTCAGGGAAAGACTGAAAACGCGGGTCGCGCGGCTGAAGAACTCAAGCTTCCTCTCATCGCACTTCAGCAGCACCCCAAGCACGTCTCCATTA
CGCCAGCAGCGAGTCCCCGCCTCGTTCGCCTTCTCCACGTGACTCGAGTCCTTATGGAGATAGACTCCATGCAAAATGCTCTCATCAAAGATGTTGAGGT
CAGCAGTCCCGCAAGTGACCCCCACAAAGACTGGAGAGTCGCTCTGTGTGCGAATGCACACCTCCCAGTACCATTGACCTCGACTTAGTGCCTTGTCGAA
CACTGCAAGCCCTCCAGCGCTCTCAGTTGATTCAGCTGACCTGTCGTTTGGAGATACGTCACCCTTGTGCGCAAGCGTCAACTTGTGCAGATCAGTTCCG
ATTGTGATATTGCGCGCGCAAATGATCTTTGGACATCTCGAGCCAGCTCCAGCTGGGAAAATCGGGACCTTTTCATACTGGCTGTGCTCCAAGCTCGTGT
CGTCCGAAACGTCAAACTCGAGCGCGTTCTTCCATCCATTCCAACTTGTCAGCTCTGTCAGCAGAGACGGCAGCCTGATTCGATCAATGTGTTCCCAGTC
GCTAGGTCTGTATGGCAGACAACACACTTCAAACACCAGCAGCATGTCGTGGATAGCACGCTGCAGCAACGCCAGAGTTGGCTTCTGCTCCCCTTGAGCT
GGACTCGCCTGAACTAGAAGCTTGATCTCGACTAAGTGATCAGTGCACGACTTTAGTAGCGAAGAGAGAAGGCGAAAGAACTCGTCGCCAATCAGCGCCG
ATAGTCTTGCACCCGAAAACTCCAGATCTTGCAAGTAATGGACCTTCACCGTACAAGACGCGTGGTCGCCATCCTGTCCAGCTGAGACTGCTGATCTCTT
GAAGGCAGACGACAGAACTGGGATGATGTGGAATCGCGAGCTCGGGATCGTTTCGATGCAGTCGAGCAGTCGAAGGAATACCTTGATGCCTTTCAAACGT
TGCTGCGCACGATCTTGATGCGCTTCCAGCATATTCTTCATGATATCATCTCGAGTCAGAATGGTGGCTCCGTCCTCCGCCTCAACTGGGTCACTTGGAC
GAAGAGTGTTTGACTGCTGCAGGAATGAGAAAATGTCGAGTTGCACGCGTTCGTCTTCCTCTTCAATCAACTCGATCGATTTTGTCTCCATCAGTCGCTT
TAGCTGTCGTGCAGACTGTCCGTCGGGAATTGAGTCTACAGCACCATCCACCTCGCTACTCGCCTGGGAGAAGTCTAACAGGGAAGCAGAGGGTAGCAGT
TAGAACAGCCTTCGCCGTAATACAATGACTACACCACACGTACGCACCATATTGTGGTACTGACGAGATTCCTGGCAGCAACTTGAGAGGCGACGAGCAA
GCTTCACTCGCGACAATTGGTGCAGGTGACAACCGCAAAAGCAGCAAGGCTCGATGAATGATCGGCTCGCAAACCGTGTTGTAGAGAGCTTGCTGGCGCT
CTTTTGCAAGAGCTTCTGGGGTGAAATTATCAGTGCCAGTCTTTTCGCTATATCAGAGCCATGTTTGTCGTCAGCCAACGGAGCATTGTTTACACAACAT
CTCACGGCAATAACCAGATTGCACTTACTTCGAAAGAGCTGCAAGTTTTTGTTGTTCTCGGACGATCCTGTTCACAACAAGCAGAGGTTAGCGTTGAGTT
GATAAAACACAACAAGGTAGTAAGCTAGCACTGACTCACCAGCGACGAAGCTGCAATGCTGATTTCCACGCATCCACGATCGCCTCCGACGGGACTCCTT
CTTTGGACAATGGCTCCGCCATGTAGTACACGTTGCTGTGCTTCAAGAGAACTGCGAACGCTCCACGCACAGCCCGATCAACAGCCTCGTACCCACCGCT
TTTCTCAATTGCCGCGTCGACACTGTCTTGGCGCTTGAGTCGAGTGGCTTTTAGGTGAAGATTGTTGCCTCCGACTCCTGACCCAGGGTCCAGAGCGTGT
CGCACCTTCTCGACCAATTTCTTCCCAGGACCGACATTGTTGATGATCTGCTGTAAGAGCAGCTCATTTCGCCCTGCGCCAGTGTCAGGAGTATGTTGTT
GGTAATTGCCACTGCTCATTAATCCTCCTCGGAAGAGGGGCGATGCTACCCAACGAGGGTCCACTGCACACTCAGGTTGACGCTCAGCGCCAGTTATCAG
CGTCGCTGCGTAATGGCTACCGACCCAGACCAGAATCTTCTGCAGATCTTGTAGCCACATGGTGCTTTCCTTGAGAACTGATTCAGAGACTTCCAATCGA
TGCACCATGTCCGTCGTATACGAAGAACTTGTGCTGATGTTTGGAGTATCAGCGCCTGGCCTCTTTCGAGATGGCGGGTAAATGTGCTGGGATAAGATCG
TTCGACTCGGATTGAACGAGATATTTTCTGAATCAAACTCCACCGCTTTCAGTTCGATCAAAGCGTAGTCCTTTGACAACTCGATGACGAACATTTCAGC
TCCAAACAGCTTCATCAAGTCTGAAGGGAATGACACCCTGTGCAACTCAGAAGTGTCCTGGCATTCGATCACCTTGTAGCTCTTGAAACTCGAGCTGATG
ACAGTCTTCGTCCAAATCCTTTTCAAGATCTCGTTGTAGGTTGACAATTCAGCAGGCGGAAGTGACAAGCAGTTCGCCAGCTCTAACGAGATCTGTGCTG
ATTGCGACATATCGAACTTCGTGCATTCCTCACTGCTCTTGTGCTTTACTCCAGGTTGCGCAGGAGCATTGGCCATCGCGAGTACGTTGGATTGGTCTCC
ACTTGGGCACTTCAGAATCAGATGCGTTGCCGACGACAGTCTCTCCAATTGTGGCCAAAAATCGTCTAGAATGGAAGGAAGCTGCTCGCGAACGGCCGGC
AACGACACCACACTCAGCAACGTAAACGGAAGCAGCTTCCCAGGAAAAGTGTGCTGAAGAATGTACGGAAGTACCACAACTCGACCTGGCTGGATTGTCG
ACGCGCACTGCATGATGTCGAGCGTGAACGATACGAACTTCGAGCATGCACTCTGAATGATTTGCCATCCTTCGCGTGTATGAGTCGAGCACCAGTAGAT
CGCAGCTCGAAGGAACACGTTGAGGCACTTGAACTCGTTGCTGTTCTCGAGCAACTCGAGCGCTTTCACAGCTGTAGTCTTTTCGTCCAGGGCTTCTAGA
CCACCCAGCACATCACGCGTCTGTCTCCACAGAGAATCCAGTAGTGTATCCACGAACTTGATGATGACAGAAGCTGACGCTTGAGCTGACTCTAGTCCTT
CCTCAAATAGAAAACTGGACTCGCTCATGAGCTGGAACAGCATCTTCGCAGACGTGAAGCACGGAATCAGCATTGGGAGGAGCAGCTTGTTTGTCGGCGA
GCAGTCGCATTGAGCAGCCAACGTATCTTCAAGCAATCGGTTCATGACTTGAACTCGATCCAGCAACAACGGAAACAGAGTGGAGAATCCATAGTAGATC
GCCGATGCGGTTTCTTGCTTGACCGCATGAAAGAACCACAAGACTTCCCCTGAACTCGGAACTTTTGGCGAGTGCTCTGCAATTCGGAACAGTAGCTCAC
GGATCGAGTGAAGGACACCTCCAAGCTTCGTTGCTGCTGGTGACAAGCCGATCTCGCCAGTGTCAAGGCAGCAGCGGGATAGCTACACGCAACAATAATA
ACAATAGTTAGCCATCTTACAAGACGTGGGAACAGCATACACCAAGCGCTTAAGCTCACCTCAAAGAAGTTGAGCTTCAGGATTCGGATCGTCACCAGAA
GCGGATACAAGACCTGCACCACAAAGTCGCTCTGGTTTAATTGGTCTCCGAGCGACTGAGCATTGACAAATCGTGTCGCGATGCTTTCCAGCAGCAGATG
CAGCGCATAAAATGTTTTCTCCTTCGGATCGATGCAGAGCGATCTGTAGACGCAGCGCGAGAGCTGGACGGTCTCGCTGTCTTCTGCGGGGATGTCGTTC
CCCGCTAGTCTGTCCAGGTGAGACAGCATACAGATCGCCGAGTCTAGCGCCTCGTGGACGCAGTGCTGGGTTGTCTTGCTCGTCCCAGCCCCGCATTTCG
ATCGCAGGATACCCAAGATATGCGTTGACTTCCCAGACGTCGATACGTTTTTCGTCAGGTCAACGTTGTAGGCTCGAGTTGCGTCCGAGGTAGCAATGTT
GCACACTTGATTCACCGCCGTGACGACGCCGTTGATCTTCACGTTGCCACCAAATAGCTGCAAGTTGCCATCAACGCGAGGCGATTGAACTGAATCAGTT
GCGCTGTAAAGCGCAGTCGCCGTTCCCGACATCACGAACATAGCTGCGCCGGACCACCCTTCAACATTCTCTTCCGCACTCAGCTCAATCGAAGTCCACT
TCTGCGATGTGATCGAATAGCACCACAGGTCGCTCAGGAAATGTCCCGATCGACTCAGACCACCGTATAGCCACACGTTGCCTAGGTCCGAGCAAATGCT
GTAGTTCGCGCGCGACTCGGGCATGGCAGGATTGAACTCGCTGCGGGTCAGTGCTGAGCTCTCGCCGCCAGCTTCGTGCAAGCTCGATATGTTGTCATCG
TGGCATAAATGCCACTGCCGATCAAACGTGTTGTATCGCCACAGATCTGCTCGGAATTTGTCCTCCTTGTCCTGACCGCCGAACACGTAGACACACTCTC
CGATAACGGAGCACGAGCAGCCGGTTCGTGGACCTGGGTCCAGTGACAGCGAGCTTGGAAGACGAGACCACGAATAATCGTCAAGCGAGAGGTACCAGGC
ATCGCCCAAGACCTCGTTTTCGGTGGACCTGCCTCCGTACATGAAAACCATCGAGTCGAGACGGACTCGAATCGACGCCGCGGTATGGAATGCACGAGGC
TGCGGCAGGGATGTTGCAGCGCCAATCGATCCTTGAATAAGCTCCCACGACGGGAGCGACCCATCAGCGCTCTTCACTATCGAGCACTTGTACAAATCCA
TGTGACGGGACGACGGTGTGTTGCTCTCGCCTCCGATCACCAAGATCTGGTCGTCGTCGATGACAACGACTTGGTGGTGACGGATGCCGATGGGGAAGTC
AGCCCACTTCTCCCAGCGCTTGTTCTCCAGATGGTACACCCACACTTGGTTGCTAAGGGCATGCTCGCTCTCACTACGAACATCTTCAACGATACTCCCT
CCAACCACGAACATCATGTTCTTGACCACCACCGAGGCACTGCCCTCGAGCGTAGGCGGGCAGCTCAACAGGTCAACGGCAGCTTTCCCTGGACCCTTGA
GCACAGCGCTGGATGTTGGAGACACAATTGCTCTTGAGATGCTGTCAAAGTCGCTCGCAATGGTTGGCGGGTGGGTGAACGGCTGGTGGCCAAGGTTGAC
GCGAATGATTTCACCGCGCTCCAGACTGATGCCAGGCATGAGTCCAGACTTCTTATCCGACGTGTTGAACTTGAACTCCGAGTACGCAACACCCAGATTG
ATGCCGTTCCGGAAGAACGTCATCTCACAAGTCGTCAGATCCAGCAAACATCCAATGACGTCGCCAGCTTTCCACTTTTCGCCGTACGATGACGAGCCGC
TGTTCCACCGCCGCTGCCGGTTGCCGTCGTAGGACCACGAGTGGGCGTGGTCGCCGACACCCTCGCCTTGGTCAGAGCTTCCTTGGAAGTACCCATCGAT
CCAGCCAATCTGAATGAGTCCGCTGGTCACGACTTCGACTTCGTAGAACCATTTTCCCTGGAACAGTGCGACACCAACCGTCAAGATTGATCCGAAGTTG
CTCAGCCCTTCGATTTCACCTGATCGATCAATATCCACTCGCCCGCACACTGAGACGATGCAGCTTTGATCGAGCACAACAGCATCGCCGTCATCGTTCT
CGCGCTTGCGCTCAACAATAAGAGACGTTGTGTAAAAGCCCGCAGCCACGTCGATACAGCGTCGCGAGTTCTTCTCCGGACGAACTCGAAGAGGAACTGG
CAGCAGGGAGTCTGCGCTTCCTCTGTTGCCGAGCTGGCCTTTGTTGTTTCGTCCAAAGACAAACACCTGTCCTTGTTCAGATAAGAGAACAGTGTGGTAG
CACCCACATGCGCCACGGATCATTCGCGTGTTTGCTGACAGCGCGACGACGTTTGGCGCGTTCTGATGGATCTTTGAGCCGATGCCAAGCTGCCCGTAGT
CGTTTCGACCAAACGCGAACGCCCGTCCAGCTGTGCTAATCGCAATGGAATGATAGTAGCCGCACGCGACGAAGCAAATCATCTCGCTTGGCACCGCAGC
GAGTGTTGGTACTTTCACTTGGCGGCTGTGACCCAAACCAAGCTGGCCGTAGTCGTTCTTGCCACACGACAGCAACTCACCAGTGGCTGTGCATATGATG
GTGTGGTAGAGTCCACAGCCGACCATCGTGACTTCGTGACCCTCGAGAGCTTTCACATGCTGCGGAGTGGACTGGTGCTGAGTGTGGTCCAGTCCCAACT
GGCCGCAATCGTTCATTCCAAACGTGTAGAGTTCGCCAATGTCGGTCACCAACGCACTGTGGTGGTAGCTGACCGCAGCATAGTTGAGCTTCTTGTCTTT
CATGGATTCAATCAGCTTCGGGATGTGGATCTTGGTCGTCAGATTCTCGTGTCCGAGCTGTCCGCGATCGTTGTATCCCCAGGAATAAGCCAACCCAGTC
TCGGTGAGGGCAATCATGTGCTCGCAGCCATTGCTCGCCGCAATGAACTTGACTTTCTGCGACCGCAGCGCTTGAACAGGACGAGGAAGCATGACTCGCT
CGTCAAAGTGACCTTGTCCGCATTGTCCACTCTTGTTCAGTCCGCATGTTAAAACAACACCGTCGTTGGTGAGGATTGCCAGGGTCTCGTTGCCGCTCAC
GATCATGCGAATGTCGTCCCAGCCGCACATTGAGACACTCGTCAGCTGATGGCGCTCAATGTCGTCGCCAACGCCAAGTTCGCCGTACGAGTTCTGACCA
CAGCAATAGAGCTCCCCTGATGCCTCGCACTTCCCGTACATTGGTTGCTCCTTCAGAGCTGCCAGCTTGGATAACGTCACACCGATGTTCACACATGTTG
ACGGCGGCTGCTTCATGAGCCACGACACGACAAAGAGTACAGTCGCCAGCGAGCCGCGCACCATGCCAACTTCTGCAAGTGCTTCAATGGTGGATGCACC
AAGGCGCTCCTCCATCTCGGCTGGTCTGTTTTCAACTGGATATGCGAGCTCGCCCAAGCAGTCGCTCAACAGGTTGAACGCCGACGATGCCGACGGCGCG
AGATACATGCTGTCGGAATACGTTGTTGGCTTGAGCGGCAACAAGTTCTCCTTGATCATCTGCAGAGCACGCACGTAGTGCTCTGGATTGTCTGCTCGTG
TGGCCTTGAGCAAGTGCACGACCAAGTCCCAGCCCATTGTCATGCAGTTCTGCGTCGGCAGCGGCAAGGGCGGCGGCGTCGCCTTGCGCTGGGAAGCCGC
GTGGGTGCGTGCAGCCACGAGTCGCTGCTCGTATCGATATTTCTCCTTCTTTGTGAGTTGGTACACGCCCTGCAGGTTCTTCACGTAACTACCAACGCGC
GCTTCAAACATGCCCGGCACAGCGCGATGCTCTCGTTTGGACTCGCCGACCTGACGTAGCGCCTCGCCTCCAGCACGACCGAACTGGTCCATTGGCGTCG
CAGCCAAGCTGGAAATGTACTGGAACAAGTCGTTCACCGAGTCGACTGAGCTCACAATCTCATGCATTTGCTGGTCTGGACTCTGAACCGCCACTACACC
ACCGACTTCATTTTCTGTATAGAGAGACATAAAGGGTACGGCGGTCAGACTCGAGAGATTAAATTAATGCCCACAGCATGGGAATCTGTTGCTTCACCTT
GAGGAAGACACTGGATCGCATGGTTGAACTCCAAGATCTTGCTCATCGCGTCCTTGATCTCGTCGGTCGTGGTCGTGACGGCCCCGCCTGCCGCATCCCC
AGCTTTGACTGTGTCACAGAGCGCCACATAGTTCGGCGGCAGCGGTCGCAGGCGCGGCTGTCGCTCGTCGGCGCGAGTCGTCGGGCTTCGCGTGACGCCA
CCAGTGGGGTGCGACCCTTGCTGGCCCATACTGGACACGCAAACTCACACTGTGTTCTCCGTTCTCGTCGCTTCTCCTGCTTGCAATCAATCTCTCGTTC
TTGAACGCCGCAGCTTTCTCTCTCACTGTATGTGCCACACACACCACTTCACCTGCAGCTTCGCTTGAACCGCAGCAGCTCCGTGGACGAATGGACAAGC
AAGCGACTGCGACAGAAGCGTGAATGAAAGATCGTGGCGCTTGGCGACCGCGCCGATCGCCAACGGACGCCGCTTCAACCTCGTCATCGTGCCGTAATTA
CGTCTTCTGTATGCGCGTTTCTTTTTTACGAGGCGTTTCGCCACTGCTTTGGCATCTGCTGCTGCGGCGTGAGGTTGCGGGTTGCGATGCTCGGCGCGCC
TGCGTGTCGACGGACTGCCTGGACGAC