Description :
From Genome Similarity Track
Location :
Scaffold_1959:895- 2149
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1959-snap-gene-0.1HECT ubiquitin ligase

Sequence
1254 bases(100 bases per row)
CGGCATTCAGCATGAACAGTATGCTCTTTGGGGTGCTCGCGGGCTTCATGCTCTGCTGGGCGCTGCTCGTCGTCTGCATCCGCAGGTCCTACGCGCAGCG
CATGCGCGACGAGCGGCTCAACGCGCCGCTGCTGGGCGAGTACGTGCGTGTGTGTGTGTGTGTCGTTATGACGCAGCAACTTGTGCAACATGTTTTGAAC
GTGTGTGCAATAACTAACACTTGCGCTTGCGTTGTGTTGTGTTGTTTGTTTGCAGCTCGAATGAACACCGCTTGGACGCTGCGATCCGGTATGTTGGAGT
GAACTTTCTGCTGCTGTATTGCCTGGTGCTGGTGACTAATGGTTGCTATGATGGATGTGCTGTTGTTGTTGCTTTGACAATATAGAGGAGCGGAGGAAGG
CCACAAGGAGTGTGGTGTGTGCGGCTTTGAGAACTTCAAGCGCTTCTTCTTCTGCAACATCTGCGGCGAGAAACTGCGCAGCAAGAGCTCAACCAACCAC
AACAACAACACCAGCACCAACAACGCAAAACCAACAACGACAACATCGACAGCGCTGGAGCGCAGCCGCAGCAAAGGCGCGAGCGAGTATCGGAGCGAGT
CCTCGCTTCAGCTGGTTGAGTGCTCTGCGAGTAGCGAAATGGCGGTCGTGGTGCCACGTGCACTGTTCACACAGCGGCAACGACGAGCCAGGTATGATAT
AGTAGCTAGTTACTGGTATTGGTATCCTAGCGTTTCTGTATCTAACGTTGCTATTGGTTGCACTTGTGTATAATGCGATGGTGGGATTGTTTAGAAAGCG
CAAGGAGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNTGAGGACGAAGAGCTCTTCTGGTATCGCGATAGCAGCTGCGGAGCGGATCTGCGGTTCTCAGG
GTACACGCTGCAGTACCAGGGCGACCAGGAGGTCAAAGAACCCGAAAGTAGTGCTCAGGATCGTCATGAAGAAGAGTCGCAGGTTGAGCTGGAGCCAATC
ACGATTGTGGTGGAATCTGTCAATCCTGAAGGTGCAATCAACGGTATTCCGGAACCCAACACAAGCCAAATTGAGCCTTCGCCAGCATTCGCAGAGCCGG
AATCGAATGGCCAAAACAATGGAAACCAAAGTGAGAGGCCAACAACGATCGTAAACGAGCAAGCCGTACAACAAGCGAAGGAGAACTGTACCAAGGCGCT
CAGTGACGCTGTTTCCACGCTGTCAGTCCATCTCCTGGACGCATCATCCGCCGA