Description :
From Genome Similarity Track
Location :
Scaffold_107:89470- 91970
Transcript NameFunction/comments
Hyaar_Emoy2809678GA28525
Hyaar_Emoy2809679hypothetical protein

Sequence
2500 bases(100 bases per row)
AATACACCATGACAACTAGCCAGAAGTATCCATCCAGCTCCAACAGCGAACACCGTCCTCGCCCGCTGACAACACCTAGCACGGCACGCAGGCGCTCTTG
TCTGCGCAAGGGAAGCGCCTTTGTCAACGGCGTCGCCCTTCAGGGCTCGCGTCTGGATGAGCTGTCCACGACCAAGACGATCACGGTCAGCTACTCGTCC
AAGGCAAAGAAGACCATCTCGTTTGCTGACCAGCGCGGTCAGTGCTTTGTGCTGGAGCGAGAGTTTAGCCGTGAGGACGCGCCCGTGTGCTGTTGCGACA
TACCTAGTGGAGTCACAGTCGACCGAATGATGTGCCAACGTAGCAGCAGCATCGAGAAGTTGATCGACGAGACGTTAACGCACCAGCATTTGCTGGCTAT
CTGCGTCGTCTCTCTGCTCGGTTGCGCCCTTGTCGGTTTCCGTCAGACGACCAAGTAGCCTTGATGCAAAACAAAGCCTCTGTACGAGTAGTTGTAATAT
CGTTCGTCTGTGAGAATGTTATCGGCAAAAAGGAAATAAACCAACCAATTCCAACATCTACCAGCAAAGTTTCACAATTAGCGGATCTTGCTTTCACCGC
TTCCAGGAGCTCGCACTCTGTACTTGTCCAGTTCAACTCGCTGCTGCAAAATGCTTCTCAAAATCAACTCGGACGAGTATATATGCTTAGGATTGACGTC
CACGAGTTGCATGCGTACGGCTGCGGTAGCTAAAGCCGCTTCACTCGAGATAACGATGTCACCCGGCGCAGGCTTTCCTTTCGACGTCGCCTTGCCACCG
GCGTACTTTATGATCTTTACCAAGTCATCCACTGGTGGGAGCAATGACTTGTGGTTGGTAATAAGCACGCTGTAGTTTGCAAGCAAACGTCGGCGATGTT
CCACGGCCACGCCGTACATGGTCGTTCTTAAATCAAACTGCCACTTGCTCTCCGGTTCCACGTCCCGAAGGCAATTCGCGTGCTCATCAATAGCCACACC
AGCCTGCGCTGACTTGTCAAGCCACTGTTCACCCACAATATGGGTGCAGCACGAAATGCCGCATAGTAATTTTACCGTGCGCTTGAGCTTGTTCTGAGGA
GCAATCAAATGCGTAGCCTTTTCGATATCACTTTCGTAAACAGCGCCAGCGATCGACTTGATCTTCTTGCGAATAACGGCTGTTGGCTCGAGCCCCGTCA
AAATAATGCGAATCGACCCTCCTTGAGCTTGTTTACCTGGACAGTGCGTGCGCTTTCTGCCATGACCCGTAGTTGGCAACTTACGCGGCGAGCGTGATGC
CGTATGAGACGATGTGTTCCCTAACATATCGAGCCGATCGCCCTCGTCCAAAATGTCTTGTAATTTATCATCGATAACTTCCGAGGAATCACCATGTGTT
TCTGCGTGTGCGTATGGAACATCTTCGTCGCTGCATTCCTTACCTTCCTGATTTTCGAATGAATTTGGACGGTACAAGCTGTGTGAAAGAACTCTATCCC
TATCACGATGAAATCGATCGGTGCCGTGATACATTCCTTCACGAGCTTGACATTTCTCACGATTCGACCTACGAGATGGCGATGTCAACTCGTGTGTCTT
TTTCGTCGTCGATATAAGTCCGATACTCTTCCTTTCCACAATCGGTAAATTCCCCTTTAACGCCACCTTCGGAAAGCTCACGCCTTTGACTACATTCGAC
TGCATTCCATCCGTCGAGAACGTTTGTTTCTCGCTTAAGTGCGCATGAAACTTCGCAGGTGACTCTTCCTTTGGCTCAGCCTCGATTTCAGTCTCACCAC
CACTGCTGTCAATTGCGTCATGACTCGAAAGAGCTGTTGACACACGAAGAGGTCTGGACAACATGCAAATCCTTTTCAACCCTTCGGATGTTCGCGTTCT
TTTTTGTAGAGAATCAGCGATCGAAGAAGGCGCAGCAATAGACCCAACTTGTTCTAACATATCGTCCGACATGTTTGATTCAGCATCGTCGTCACCAGCT
CCGATGCCAGTGTCCTCATCCACCGCAAAAGGTTTTGGTAAAGGCACAATTTCTTCGCTTGAACTTGTTAATCTGGAAGCTCCTAAACTCATTCAAATGC
GCATGTTCAGACGTCATTATCCACAACGCCTTCCGCTTCTGTAGCATGCCTCCTACCTTTCTGCTCTCCCGAGTTTGTCATCCAAATCTGTGTCGCTTCT
TCATCCAATCTGTTCTTTTCCTGAACCCCATCTTCCTTCTCCTGAGACGGTTCATAAGCTACAAATCCAGGTGCTCCAGTCTCTTCAGAAGCCGATGCCA
TTTCTGTTTCGGCCTGCGTCACCTGACTATCCGGTTGCGTCAGTTCCTCATCCATCGCAGATAACGCAGCTCGTTTGCGACGGTTTGCAGTGTACCATTG
GCTTGGTGAGTCTTCGAACCCCACGGGTGTTTTCTGGCCTGATGAGTCCTCGTCATAAGCGCATGTAGCCATGCCGCCGAAAATGGCCCAAATTAAGGGT