Description :
From Genome Similarity Track
Location :
Scaffold_591:8945- 14453
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_591-snap-gene-0.7CofD
Pytar_ATCC12531maker-par_contig_591-fgenesh-gene-0.4SET binding factor 2

Sequence
5508 bases(100 bases per row)
GTCTGCAGCTGCGGTGGCGCGCTCGCGGCGCTGTCGGCTGCCCAGCGGCGAGCGCGTGGACGAAGATCCGCGACGCCTCGATGCTGTCGTCATGATCCTC
GAGGACGTGCTCTACGACCACACCAACATGCTTGCGCACTTTGCGATCGAGCGCGCCATCCAGCAGCTCATCAAAGAGCGTGCGTTCTCCAATACGTTCG
CGGCCTATGAGGCGCTGCAGGCGTTCCGCCATTCTTTCGGATACCGCAAGCGGTTCCCTCGCTTCGTGGACAGTCTCATCGCCCAGGAACGGCTCAGCTT
TGCGTCGGCGCAGCACGTGATCCGCGCCTACTACGAGAGCCAAATCGCCGAGGCGCGCACGATCCGGCCGTTTGACAAGGCCCGCGAGACGNNNNNNNNN
NNNNNNNNNNNTCCACGGATACCAGCTCGGGCTCGTGTGCGTCGGCAAGGACGATGTGCAACTCGAGCGGCTACGTACGCTCGGGCTCGACGATCTCTTT
GGCGAGATTGTGTTTGTCGCGAGCAACCCAAGCGTGCTGCAGTTGACGCAGGCCATGAAAGAGATGAGTCGTCGGCTGATGCTGCAGCCGTCGTCGATGC
TCTTTGTCGGTCGCAAAGTGTTTTACGAGATCAAGGCCGCGAATAAAGTCGGTCTCGTGACGGTGCGCATGGTGCGTCAGTCTCTCCAGCTCATGTCCTT
CTTCAGTAGTATGGAAATGAAAATAACACTCGCGAATGTTGGATTGTGTGGTTATTGGGTGGTGTAGCTCCACGGCAAGTACTCGACAGTGATGCCCATT
GAAGAAATGGAGCAGCCCGACTTCCAGGTGCGTCGTCAAGAGAGACAGGGACATACTGGCAAGTGTATTGACTGACGTCTTGTGTCTAGATCGGCTCGAT
TGATCAGTTGCCGGCAGTCGTGCGGCTCGCCGACCAGCAGCTTATTCGTCCCAAGATCGTCGCGCTCGGTGGAGGCACGGGACTCGCCGTGCTGCTCAAA
GAGCTGCGCCACTACCCAGCAGACCTCACTGCGATCGTCACGGTCTTTGACTCGGGTCGCCACTCTGGTGCACTGCGCAAGTACCTGGGCATTCTGCCGC
CTGGAGACATCCGCAATTGCTTGGTTGCCTTGTCCGACTCGGGTGCGTGAGGGAATGGGGAATGAACTCTATATAGACTCGTAACGCAACAGTACTGACA
AGATGACTGAAACTCTACTCTAGACGAGGTCATGAACAAGCTCATGAACTACCGGTTCAAAGAAAACTTCATGGAAGGCTGTAGTCTTGGAAACCTGCTT
CTCGCGGCGCTCACCGACATCCAAGGCGGCTTTGACAAGGCCGTCACGTCCGTCTCCGATATTCTCAACATTCACGGCAACGTACTGCCGGCGACGCTCG
ACAGTACCGAACTATGCGCCGAGCTCGAGGACGGCTCCGTCGTGGTCTCGGAAGTCAACGTACGAAGTCCGACCATAGTCGATACCGACNNNNNNNNNNA
CCGACGGTCAGGAGAGACGCAAGTCACCCATCAAGCGCGTGTTTCTCGAAAAAGACAACGTCCAGGCCTTCTTGCCGGCCGTCCGGGCCATCGAGAATGC
CGATATCATCGTGATCAGTCCCGGCGGCTTTTACACGTCCATAATCTCGACGCTGCTCGTCCCCGGCATTCGGGACGCGATCAAACGAAGCGTCGGTGCC
ACCGTGTACATCAGTAATGTCGCGACGCAGTGCGGCCAGACAGACGGCATGACGCTTCCAGACACGCTCGCAGTCTTGAAGCAGTATGTGGGTGAAAATT
CGATCGATTATATCATTGCGAACAACGCGACACCGTCGCCAGAGGTGATGGAGTCGTACTTGTCGCGAGGTGAGACGCTGCTGGTGCCGACCGACGAGAT
GCTGGCGCGGCAGCAGCCCATTATTCTCCAGGGCAAGACCTTTGAAGACATAGACGACACTCTCCAAAAAGAGTGGGACAAGATGCCCATGATCAAGCAC
TGCGGAAAGACAGTCGCCGGGATGCTCTACCGCATCATCGAGCAAGAGATTGAGCGCATGCGCGACACAATGCGGCAAGGCGGCCACTTTCGCCACCAAC
CGCCCGTCTCGCGAGAGAGTCGCATACCGACGAAGACGCCGGAGATCCACAATGGGACAGTGAAGGCGAAATCGTCGTCGCTCAAAAACCAGCGACCAGA
AAGCTTTGCCCGTGTGAGCGAACCAACGCTCGGGACCGACAACACAACGTCGCGTGTGGCGCGACGACGCACCACGCTTCTTGGTTGCCTTCTTCTTGGC
GTCGTCGTGGTATCCACAGTATGGCGATCCTCGCACCGTGGGTAGTCATCCCGATAACATCAAACACAGCTTAGATGTCCACCTTCTTGCCTGGCTCGTA
AGTGGAAGCCGTAGAGGACGATCCGATCACGTCTTCAAAACCATTGAACGACACGACGTACTCACTGAATGCCTGCGTCGCCGCGAACAGCGTCCGGAAC
TCTCGAGCTTCGGGGGCCGACGCCGCGAGGTAACTCGCCTCGTCAAAGAACGTCGTCTTCTTGCCGGAAAACTCGTCGGTCCACACGTACCGATGGTAGC
CAAACTCGCCAATGAGTTTATGGATCGTCTGGTAAAAGTGTCGCCGCACGGCCATGTCAGGAAACACATGCGGTTGCGTCGGGAAGCGGTGCGCAAAGAC
GTGGTCGCTGCGGTTGACATTTGGCTTAAGGCACTCATAGAGCCCCTCGCGCAGCGGAAAGAGAATCGTCGACGGCAGCTCACATTCGACCTCACCACGC
ACGATACAACCCTTGTCCACGTCCACAACGAGCACGTCGTCGCTGATGAGCTCAGCACGCATGGCTTCCTCGAGCGAGTCCTTGGATACACCGAAAATGA
AAGGCGTTGGGCACTCGAGGTACTGCAGCATTCTGCGTGGCAGCACAGGAAGATACACGTGCGGCCACAGCAGCGGGAACATGATGGCTCGCATGGCCTC
ACACACGCGCATGAGCACCGACAAGTGTGTCGACACAAACAGCACTCGGCTCTCGAGCAAGACGGCCGCAAACACGCGGATCACGGTCGCGACGTCCAGC
GTGTCAAACAGCAACCGAATGGAATGGTCGAGGCGTGGAAGGGGCGGTACTGGAGCTGCGTCCAGTGTCAACGTGGGCAGCGCTTGTGACGAAAGCGGTT
CAAATGCGACCGACCGCGAGATCTTCGACACGACCTTCTTGTCCAAGCGGAACGGCTCGGCCCCCACCGACGCCTGTTGTTCACTGGCGGTCGCTTTTTG
ACGTGCGATCGTCTCCAGCTCGATAAGAAACTCGTAGCCCTCGGCGAGTCGCTCGCGAAGCAAATCCACGAGTGCAAACTTGGACAAAATGCACACACCG
TACGGCACCCAGCGAAGCCCGAGGCCGCTCTGCGTGTCAAGTCGCACCTTGTCAAAAAACGATGGCGGCAATGGCGGTGCCGGTTTGTACATGACTACAC
AAGCGGCATATAACTCGTTGGACGCTGAACTATCGCCCATTTTGAAGTTGAACGCGATGGGATCAGGACACGTCGAAGCGTGGACGACAATATTCTCGAG
GTCCGAGCACCAAGGCAAAATAAAGCTTTCGATGGAGCGGTCAATGCCAAGCGGGCTCGGTTTCTCGAGCGGCATTTGGGTGACACTCAACGCAGCCGTG
CCGGCAGCGGCTTGGTCAGCATTGCAAACAGCGTCAAACGACAGCACGCCACAGATTGCTTCAAAGCCGCGCGTCGATTCAAACACCTCGAGTGATCGCT
TGCGGAGAGCCTCGCGAGAAGCTTCCTCGGGCCAGTGGTGGACCCGCAAACCGTAGCCCAATAACAAGCCCGACAAGCGACGCAAATCGTCCATGGATTC
TTCGTCTTCGGGGCTGGTCGGATAGAGTGCAAACTCCGTGTACGCTCGGCTCATGAGGAATCGGTGGTACAACTCGACGTGGATCAAGTTGAATTTCGCA
AGGATTGCATCTTGCTCGCGTTGCAGCCGGGCAAACGACGCGGTCACCGACTTTTCGAGCTTTTGCATGTCTTCGTCGCCTGGGTAATACTTTTCGCAAA
TGTAGTGAAGCAGCTTCTTGCATTGCCGCGACGCGACTTCTTTGGTCTCTTTGCGGCGCCCGTGTGTTTTGAGCATGGCCGTGTACGCACGGTACGCTGG
CTTGAACTCGTACTCGACGTCGAGCCAAAACGCAATCTCGCGATGGTAGTTGTGTGGGAACAGGAAAATCCAAAAGAAGTTGGCAAATCGGTGGTTCATC
AGCAAGTCCTCGAGGGCAATGACTTCGCGCTGCACCGACTTGCGCATCTCGAAGAACAGTTCCGTCTTGCGGAACTGCGGGAAGCGCTCCATGAGATCCC
GCTTGACACGCGTGACAAGCGAATCAAACGTCCGCAGCGCGTCTTCACCACCGGTCGCAATGTCGCGTTTAATGCGATGCAATAGTTCCGTGTCCACGAG
GTCGCCGCCAATGTGGAACTGCGCACCCTTTGTGAGGTATTTGGTCGCGATCTTGACGCCATACGTGCGCAACATGAGAATGTCGTCTTTTGTGAACATG
GCCGTCGTGCTCACGAGACCCTGGCGAGATCCGTTGCTATTGGAACCGGAATTATTGGCGGCCGAGCCTTGGTAGTTGCTGCGAAGTGTGCACCAGAATT
GGCGGTACTCTTCAAACGAGCAGAGGAAGAACAGCTTGCTCTGGTCAGACGCGTCCTGGAGCCACGCGGCATAGTACCGCATCATGCGCGGATTGCTCAC
GACTTCTTCGAGCGACATGAGACCATCCGGATCGCGTTCACTGTTGGCGTTGGCTTGCACATTGAAGTAGTCTTGCATCCACCGGTTCCATTTCTGGAGC
TTGGCGGCCCCGGGGGCAGAGCCCAGCACGCTGTTGTTGGTCGGCACGCTTTTCTCATAGTCAGCCACTGGTTGGTGCTGAGACAGAATCGCCCTTTGCT
TTTGAGCCCACTCCTGAGCGGCTGACGTCACAAAGGCATTGCTGCTCTGGTGAGACGGCGCCACCGACGACTTACCACCCCCCATCCCCGAGAACAGAAA
GTTGCGCGCACGCAGCTTGACGTGCTGCGCCCACCGCGAGCGGGCTGCCTCCATTTTCACGTCTTGCTCTTCTTCTTTAATGCTTGTCATGGGCATGGGC
TTGACGTTCGCCGTGCTCGTGGCACTTAGCACTTCCGAGATCTCGGAAATCGAGAGCTCGCGTTCAGGTTCAAACAGCTCCGATTCGCGCAGCATTTGCT
CCGAGATTGTGCTTCTTCGAAACGTGCTTCGGCCCGAAAACGATGTCGTGAGCAGGTCGGAAAACCGCGAGGACGTGAGATCATCGCGGTCCGAGTGGAT
CGACGCGCTGCGCGAACTCGCCATGCTTTCGCGGATCACTTCTTCGGCCGAGATCGTGCTGTCGGGGGGCAGCGGCGGACTCGCGTCGAGCATGGCGGCT
AATCATAA