Description :
From Genome Similarity Track
Location :
contig_15:894487- 896940
Transcript NameFunction/comments
g3540.t1hypothetical protein PHYSODRAFT_344137
g3541.t1hypothetical protein L914_18588

Sequence
2453 bases(100 bases per row)
GGACGTGGCCTGGAAGTGCACGGCGGCGTTCGTGCTGGGCGCAGCGGCGCACTATTCGTGTCCTCACAAGTACTGGGCGATGCATCATTCCTCAAGACCC
CAAGTAGCAGCATCAGCGACAAGGAGGAGACCCCGAACCCCGTCCAGGTCCTCGTCAGGTTCGTCAGACGACTGGGAGGACGAGGGCGAAGCCTCTTGGG
TGCCTCACAAAATGGTCATGTGCGTGCGCACCGACCTGAAAATGGGCAAAGGTTGTACCCACATGGATCAACTTTTGGGTATATCATACTGACGCAGTTG
GATTGCCAGGCAAGGTCGCTGCGCAGTGCTGCCACGCGACACTGGGCGCGTACAAGCGGGCGGCGAAGCGCACGCCGACGCCATCGAGCGTGGGAGATGC
TGGGTCAAGCCAAGGTCTGCCTCAAGGTGGACTCGGAGGAGGAGATGCTGGCGCTGGCTGAGAAGGCGGCGAGCACGGACTCGTCAACTACGTCGTGGTA
CGGCTCAGTTTCTGTGTTCGTGTGTGGAGACGTGAGTGTTGATGGTTTTTGTGTGAGTAGATTGACGCCGGTCGGACGCAGATTCGCCTGAGAGCAAAGA
CGGTGCTAGTATTGGACCAGCGCCGCTGAAGGCAATTGACGAGATCACGGGCCACCTCAAGCTCATGTGAGCGTGAACTGAATAGGGATAACCCAGGAAG
AGAGACATCAACTGTGTCGGAGTGAACTGATGGTGTTTGTATTTAGCCTTTTCCTGTCTGCTGTGATGGCAGAGTGGAGGGCGGTCGCTAGAGCGTAGCC
ACGGGATCGTACTGCGTGCGGCTTTTAAGGATGCCAGCGCGCCGTAGGATGTAGACGGCCACAGCAACGCACGTGATGGCGACGACAGTTGCTAGTGCAG
TCGCTCCGATTGTTATGTACACATCTGTCGCTGCCAGATCGTAGAGCGAGGAGCTGGACCCGGACGAAGTCGCTGAGTCCACGTCAGCCGGTGACTCGGA
GGTCGGATCGTTGCTATCCACGCGAGCGGCAGCCATCGTTTGGATAGTGTCTACACAGGCCAGGAACTCGCCCTGTGTCGTCCACCATTTGAGCGTGCAC
AGCGTTTTCGCGTGGCAGACTGCGTCTTTGCAGGGTCGAGCATTGGGCGAATGGGCCTTCATATTCCAGTAGTAATCTTCCACCAAGGTCGCGTTCTGCT
CAACGCGCTGCACAAAGGCCGCGAGCTCGGACTTAGATAGTGACTTGAGGCCGTAGGCCTCACTCGCTCGGAACAGAAGCTTCCAGTCAAGCTGCGGGTC
GCTCTCGGCGATAGAAGAGGCATACACAGCGTAGTCGAGCACGTCGTACGTCTCGGTGTCGTAGTCCCAGACCATGAAGGACGGGTTGTTGCCGAAGAGC
GGCGAGATGGAGCCCGTAATATACATAGGCAGCAGCTGGAAAGCATCATCCTCACCGTCGAGTGACCCCACAGGCACGCGGAACTCGATACTGTGGACAT
GGCCGAAAAACTGCGCCTTGATTACGTCGGCATACTTGCCAACGATTTTCTTGTACGCCGCGATGTACTTGACGTGCCACTGCGGGTTGCCTCCGTACGA
GTCCACAATCGGAGCGATGTGGCCAGCAATGTATGCAAACTTCCCAGCGTCCTGCAGCTCAGCAAGGGTCGTATCTAGCCACTCAAACTGTCCAAACGGG
TCTGGCTGGTCCGAAGTGTCCGGCAAATGACTCGGCTGCACAGCAACAAAACCCATCAGTCCCAGCCCAATCTCCAAACTTGCAGAAACCTACCGAGTAG
GGCACTGTGTTCAATGTGACCACGTGCAGCTTGTCATCCAGTGGGTAGCTCAAATATCCTCGTCGGTTTAGCAGGTCCATGTTCGCAGCCGAGAGCGAGT
CCTCCCACACGCCCGAGATGATCTCAATGGATGGGTTTGTCTCCTTCTCCGGGTCCGTCACCTCCATGTGATAGTCTGGGTCTGCACCCGCATCAAATCA
CAACAATAAGGATCTCTCCACAAAAATACCAACAAGAGTCTCCTTACTCGCGTCTGCATTGCCAATGATGGCCGTGGCCTCGAGTCGCCCGTCCTGATTC
TTTGGCGGGAAATAATTCTCCATAACGTGGACGTTAGTCTCCACTGCTTTCGTAATGTATTCATCGCTGAACAGCCCGTGGGCTGCGTGGTCCCCGTGTA
CAGGAAGAGATCCGGGTCGTCCACACGTGCATCCTTGGGAAGACCAGCGCAGACTCGACAAGGGCCAGTGGGGCGTCCGCGAAGTAGCGGATGGGGACGC
GCGCGTTGTCCACCGAGGAAAAAGACGCGGAGATATTGAGGTGCACGTCCGAGAAGTGCAGGATGCGCCCCGCAGACGCCGGCCAGAGCAGCAGCGCCCA
AGCGAGTGACGTCAGCCCCAACATCTCTAAATGTGAGGATCAGAGACTTCCGA