Description :
From Genome Similarity Track
Location :
scaffold_697:8944- 15469
Transcript NameFunction/comments
Pl_102920hypothetical protein PHYSODRAFT_533283
Pl_102921hypothetical protein PHYSODRAFT_551372
Pl_102922hypothetical protein PHYSODRAFT_342190

Sequence
6525 bases(100 bases per row)
AAGCTACTTTCCATCTTGTACCAGATCGATAATGTTATTATCGATATTCCCGTGGCTATAACCTATTGCAAAGGGGGAAAAGTATCAATGAAAGTAAAGT
ATGCTGACAGTGCACTTACCACCGCAGAGTACATATTGCGAGAAGTTATGTCGAATGGAGAATTCATTGTTTCAAGTTGGGGTGCATTCAAGAGCTTCAT
GAAGAACATTACGTTTGGCGGCGTGGTGAGTACTTTAAACAAGACCGATATCACGTCGTTGAAGTCTGCTCTCAAATCCAATTCCACCTGTGGCTACGAC
ATGAAACGTTTGTTGGATCGTACGTGGATGACTGTGGCTGAGTTGCGTCGTCTGAACCCCGACATCTCCGAGGACGACATTCGTGTTATCATGAGCCACT
CGAACCTCATGCTGAATGACATCCCTATCGCAACAAATAATTGTATGAACGAGCTCATGGTGGGATCGGATGAATATACCGCATATGCCACACGTGATAA
GCTTCGGAAAACTTTTGGAGCTATTGTGGATGATTTGATTAGTTCTGGAACAAGCAACAATGGTACACTTCTTACTGCTGGAGAATATGCATTCAAGATT
GCGGATCGAGCTGTTGGTTTTTGGTCTATTTGGGATCCATTTTACATTTCTTCTGTTGTTTCCGAGTACGTCGAGCCAATTTGTGGCCCCACGCATCTCA
TAGGTGAAATTGACGATGGTAGTGCGGAAAAAGCATTAGGAATGTCCATCGTCCGAGGTGCTTTTAACAACAGCGATGGCATGTGGACGAAAATTGGTGA
CGGCACCGTAACCATTACCTTCAAGAGTGTTGATACTGAAGACGTGTCTGTGAATATCAAATCTGGAGGACACAAGATTGCCGAAGTCCCTGTTCCGGCA
GGTAAGACAGTCAAATGGATATCGAATACGACGACATTGGGAGGGAAGACGCTGTATTTGGATCGATGGCGTCCGGGTTTCTTGGGACTTCCTGGAACTA
GAGGAGGATCGCTATTGTTGTGGATTCCTCACTCGACTCAGGGTGGTAGCCTCCAGCTTAACGCGACGTTAAATGTAAGTTGATGCGTGCTCTATTATAT
CGTTCTGTTCATTAAATAGCGCGATTGACAAGTAAGTTTATTGTCAAGACCAGCTCGTTCCAAACCAGAGCAGCCCCAAAATTTTCTGATCCACAGTCGT
GATACGTAAAACGACATCAGCATAGTTGTGAAAATCTCGAGTTCCTCAAATCATCAACTAGAGACCCCAGCTAACCAACATTCGACCGACGTAGTTATCG
AGTTTTAAATCTTAAGTTTGAAGCATGAAGTATTTCGTACACCTCGATGATGAGCGACTTGCCATACACCAGCATCTTCATTTTCCTCGTCCTCTTCGCG
TACATTTCGCCACTTGATCTGCTGACTCAGACGCATCTTTCGTTCATGGAGTCGTTAGAGTTTTCTCCACTTGCGATCGAATCTGAAGCAGACACTGCGC
TCATGCCAATCATCGACTGCATCTCGACAATCACATCGTCACAGAAACTGGTGTCTCTCGCAACTGAAGATTCCCTGAGCCAGCCTACCAGCCAAGTGAA
TGGTGGAGATGTCTCCCACGATGGAGCACAGCGATATTTTGAGTCGACCAGATGGTCAACACGGGAAAGTCTTGCGGCGTGTTCAACAATGAATGGCCGA
AAAATACCCGTCTAACTCCATTCCGATGATCTGCTGCGACTGTAGATTGGTTCAAACCTAGGCGGCTATTGCTTAATAAGTGAATATCAGTACGATCCAG
TGCTCGGAAAACAGACGTCTAAAACGCATGTCAATCTCCACCTCAGTTTTCATTTTTCCGTGTTCAAGCCAACCACGAGAGGTTGAAACATGATACTCAG
GATAATTGCCGTGCTTGTAGTCTATGCTGCAACACGTGGGAATACAGATGCAGCTTCAGGGACATACACGTTTAACAGATTTACAGCATCAGCATCAACA
CTGCCACTCGCTACGGTAGCAGCATCGGACAGTATGGCAACGACTAACTCGACAAGGTCTCCGTTCAATTCATCAAGGTTGTCCAGTAGCGATGATGACT
CTCTCGATTCTTTGGATAGTGACGATAGTGGATCGACCGATAGTATCGATTCGACGGACAGTGCGGTGGATGACTCCTCTGATAGTAGTGATGACAAATG
CGAAGATGGTAAACCCTCCAGTGCGCTGTCAAAATCCATAAGCGCATCACTTCAGATTGGCAGTGTGCTTAATGTCACTAGCACGATTGAATCCACTTAC
GTGAACTGGGTAGGCACCGCGCTTGATACTTCAAAAACCACCGCGTGCTACCGTGAAGCTCACATCGCGAAGACTTGTCCGTTGGGATACGACAGCAAGC
TTGGAACGTGTTGGGCGCAGTGTCCGTATGAGTTTCCTGTAGAATGTGGAATGGAGTGCATCCGACAGAATGACGACTGCGCGCTCGAAATCGTAACCAA
GGTTTCAGCTTTGGCTCAAGCGACCCTGTCTCTCATAACGTACGACGTATTTGGCAAGCTGTCGAAGTTGGCAAGGGCTGTTCAAGTTGCTATCAAATGC
GCCAAGTACACGATGGGCTTAATCAAGTCACTTGCAAAGTATGTTCGGAATGTCCACGTGACCGACCCACAGACTCCTCAAGACAAACTGCTAGCGATGC
TCTATCAGACAGACAATATCGTAGTTGATATACCCATTGCAGTCTCGTATTGCATCGGAACATCCGCGTCGGACGAGATCAAGTTTGTCGATAGTGTGCT
TATGACCGCGGAGTACGTTTTGAAGGAGGTCGTATCGAATGGTGCCGCTATTCTGTCCAGCTGGGAGAAGTTCACAGGCTTCATGAAGAATGTAACGCTG
GGTGATTCGCTAGCTTCTTTGAACGAGACGGACATCACGTCTTTAAAGTCGGCGCTGAAATCCAATTCCACCTGTGGCTACGATATGAAGCGTTTACTGG
ATCGCATGTGGATGACGGTAGCAGAAATTCGTAAGCAAAACCCGAAAATGTCCGAAGACGAGTCAATCAAATCTAGCTGCATGTACTAGCTCTAGCACGC
TTCGCGTCTGTGCGTGCCCCGCTGAGCAACTATCCAGGTCTCACCTGGGTGGAGACGATCTCATCTCCACGTTTTGTGCCGGTCTCCGAAAGGCTAACAT
GCGTTCTTGGCCCAGTATCGCGTTCTTGAGGAGCTCGAGTATGTTGATGGCCGCGTTCACGTCACGGTCCCAGTAGCGCGCGCTACAGTCCGAGTGGTCG
CAGCGGAGCACTCCGTAGCATTCCATCTCCTCGAACTGCACTTCAGCTCGATTGCGGACAAGCACTACACCCTTGCGCTTCCTACGTTTGAAAGTGTTGA
TACAGAAGATGTGACGGTGAATATCAAATCTGGCGGCAACAAAATTGATGAAGTCGATGTCCCAGCGGGTAAAACAGCGACGTGGACGTCGAATGTGACT
GTGTTAGGAGGAAAAACGCTTTATCTGGATCGATGGCGTCCTGGTTTTTTGGGCCTTCCTGGTACAGGTGGTGGTTCGTTTGCTGTTGTGGGTCCCTCGA
TCGAGTCAGGGTGGAAGGCTGGAGCTCACTGCAAAGCTGAATGTGAGTTAATTGTTAGTTTTGTGGAAGTTGTAGATGTTTTTGTGGCGTATTTGCATAG
GATAGAGAAACATGTTAGAATAACAAATTAAGAGGAAGTATTTAATGCCCTGGTGGTAGTGGTACGTTGTGTTTCAAACGTTTAATCAAATGACACATAC
ATTCATGCTGACAGCGCTGCAAACCAGTAATTTGATGTTACTGTCCTCGCGCCACTCCACAGAGTTGTTAATACCTTGGATTAAAGCCTTCACAATAATT
ACCCCATCAAACTTGCTTCGTATCATTGTGCAGATTCTAACAGCAAAATTTAGTACGACATGATATTCCAAACTGGTTTACAGCATAATGTTCATTATTA
TTATTCGATATCACTGACCTTGTTGAAAATACTTTCAGTACTTGAAGAGCAAGTTAATGTTTGTTCGGCACGATAAAACTCATCGAGCAAAGTCCTTATG
TGTAGACCGTGAATAGCTTCGTTTTGGCGTTTACCACAGTGTACTAAGTACTGCGTGCAACATTTTGCGTTCGATGGTCTTGACCACGGACTAGCCCGGT
GTGAATAGCCGATCTTTAACCCTTTTGTGTTAATGAACATCAGTGTGCTCTTGCATCAGTATTGTCAAAGTTTTTGAACGAAGGAGTAATTCGCTCAGAA
CCGAAAGTGATTATGGAGATAGATAGTTTGGTTCTTTGATGTTGTAGGCGAACACTTAAAATGTGTCATCAACAAACTGATCGGTGATATCGAACAGTCC
GCAAAGCTGTGGATACAGGAAGTTGTGCGCCAGCTACAAGTTGAGTGCAACAAAACTCCAAGCATGCTCGAATGAGGACACTGTGCCTGTCCCTCGGCGC
GTGGGGCGCAAGGTCTGTCTCGAGCGCAAGAGAAAAATGTGGTGTGACCAACGAGCTGGTGCAGAACAAAAAAGCTTGCACTTACAGCAGAGCAGTGTAT
TTACCTTCAGAGATGTTAGCGGAGAGCCATATGCAGCTTCGTCGACCTCGACATGCGGGTTACATGTATTCATACGTGTCGTTCTTGCAACAATCGTCCA
TATTCATGTGCATGCCGACTCGGCATTGCCGAGCTGGCTATCGAACAGCGGAAAGGTCCATGCAAATCGCGAGCCAACGCACACAACTTTGCAGCAGTCG
CAAACCACTGGCGAGAACTCTCGCGGTCGGCGACCATGAGCTTATCTACGCACTGCGGGACAGCGTCTCATCGTGTATTCGTATGTTGAGAGCGGACACC
GATCCCGATTTCGGATCTGCGCACACCTCACATCACAAGATGTGGCGTCTCTCGCTAGGCTCACCTCGAGATATTTCAAGCAAGCAGAGGTGACTGGAGG
AGATGGTCCGCATCCTACATGACGCGCTCGGCGTGGTCACATTTGTCAATGTCAGATGGCTGGAAGAAAGTTCATAAGCTGGTCGTGGTCGCCGAAGCCG
CGGTGATTGGAAGAACTCGAGAGTTGAAGCTGTACCTGTCCACCGGAATCGATCTACACACGGTAAGCTTATCTGGTGAAATCGTGGTGCTCGTCACCCC
GTTCTTACCTAGAGACACGCACAAGGTTGTCGATGTACAAGGAAGCCCATCCACCCAACCAACTAGCTCTTGGAACAAAGAAACCCGTTCCGTCAACATG
GTTGCAACAATTCACGTTTGACCTTCTCACTCTTCGTTTTGCCATACGAAAGGCTCAACAAGCTTCCTCGCTGAGGCGAGATTCCAGAATCATGAACAAG
GTAGTAGTGTTGTTTGTCGTCTTGGTGATCTTCGCTGGGATCTCTTCGGCGAAGATCTTAACACTGAGCGCATGGCCAAAAACGTCAACACCGCTTGCGA
CCGTGACAACCGCTACCCATAACTTCACGGGCATGGGTGCGGTTAAGACGACCAATTCCTCTTTCAAGTCTTTAAGTCGGGTAGACGGTTCTAGCGATAG
TGAAGATGTCGACTCTGCTGACTCAATAACTGATTCAACTAACACCGTTCTTCACATTTCGCTATCCACGGACGACGACGATAGCAGTGAGGATAGCAGT
GACAGTGTCGACGATTCTTCTGATAGCGATGATAACTTCTCGCCAAGTGGGTCTACAGTAACATCGGGTTCCATGAATGCGGCACTCCACATTGGCAGCG
TAGTAAATGCTATCAGCACGATCGAGCCTACCTACATCAATTGGGTTGGAAGTGCACTCGATACTTCAATCGCCTCAGCTTGCTATCGGGAAGCTCATAT
TGCAGAGACTTGTCCTATCGGGTTCAATAGTGAGCCCAAAACCAAAACATGTTGGGCGCAGTGCCCGTACTCGTACCCTGTCGAGTGCGGATTGGAATGT
ATTCGTCAGAACGATGCCTGTGCGATGGAAATCGCAGTGAAAGTGATCACAGTGTTCCAGACTACTCTCTCCTTCGCCACGATGAATGTGTTTGGTAATT
TTTACAAGCTGGGGAAGGGAATCGTAAGAGCCACTAAGTGTTTCAAGAGTATGCTCAGTTTGACGAAGTCACTGATCAAGTACATTCGCTACGTTAAGGT
AAAAGATCCCGATACACCGCAGGAGAAACTACTCGCGATTCTATACCAAACGGATAACATCGTTATCGACATACCAGTTGCCGTCACGTACTGCCTCGGG
AAAAAAGTCTCTGATGACGTAAAATTCGCCGACAGAGTTCTCACCACTGCAGAACTCGTTTTGAGGGAAGTCATGAGAAATCCTGACGCTATTGTTTCCA
GTTGGGATAAGTTCGTGAGTTTCATGAAGAACATCACGTTGGGTGATACGGTGGACTTACTGAGCGAGGATGACATCACGTCTTTGAAGTCCGCGATGGA
GTCAAACTCTACCTGTGGGTATGAT