Description :
From Genome Similarity Track
Location :
Scaffold_281:8943- 10310
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_16371glycoside hydrolase putative

Sequence
1367 bases(100 bases per row)
GCAGGTCGGGCCCGAGAAGCACGCCTTGCAGACGCACTTGCCGTTCGAGCACGCGCCGTTCTTGCAGTCGCCCTTGGTCACGCACGCGAAGCCGCCCGCC
GTGACGTTCTCGGCGCGGTTGCAAAGGAGCTTCTGCGTCGGGATGCCCGACGCCGCGGCCGGCACCGGCACGTCGCACGTGCCGCCCTTGTCGTTGCAGA
CCATGCCTTCGCGCGTCACGGTCGTCCACGTGTCGGTCGAGATGACCTTGATCTTGTCGCACGTCGGCTGGATCCAGCCGGACGCGGCGCGCGCGTTGCT
AACGTCGACGCTGGTCGCAAGCGGCGGGACCCAAGCGCACTTGTCGTCCGTCTTCCACGCCGCCTTGGCAAAGCCCGCGGTCGGGTTTTTCTTGAACTGC
GAGAGGAGGTTCGCATACGACGGCGTCGCGGTCGTGCCGGGCTTGCCCGAGATGGCCATGTCGCCGCCCGTGAAGAGCGGAAAGTTGGAGCCCTTGGGCA
GCGACGCCTCGCCAAACGAGTAGGCGTAGCCGCCCGAGTAGACATCCGTAAAGCCGTTGGACGTCTTGGCGTCGTCAAAGAGGTATGGGATCATGTCAAA
CGTGCGCGGGTTGACAAGGTCGCAGCCGTACTCGCCGAGGGCCATGACGATCGGGACACCTTTGGCGAGGTTGAGGAGGCGCTGGTACGAGTTGCCAAAG
TTGTTGCTGTTGCACCACCGGTACTCGTTGAGGAGGTAAATGTCGATACTCTGCTGCATGGTGCCGTCGACCATCTTGTCGCCGCAGAGAAGACCTTGGA
TCTTGATGACTGTGTACTCGTCCGCGGCCGGCGCGGCCGCCGGCTTCTCCGTGTCGTCCTTCTCACCAGCGTACGAGCTGTCGGCGGCCGCATACGCGAG
CGGGAGCACGCGCATGTTGGTCGACTTGGCACGCATCCAGTTCTTGACGTCCGCAACGTACTGCTTGACGCACGCGGCGGGGCGCAGCGACATTTGCATG
ACCTCGTTGGCCATGACCATGCCGAGCGTGTTGTTGAACTGCGAGAAGGCGAGCGCGATGCGCTTGCCATAGTCGAGCAGGTACGACGGGTAGCACGACG
TGGGCTGGCTATCGGCCGCGAGGTTCTTCGTGATCGTCGAGTACATGTACGAGCCAAAGTACGCGACGTTCGAGGGCGACGCCGACACCATGACGTAGAT
ACCCTCGGCCTCCATGTCGGTCATAAACTCCTTGTAGCTGTTCTCTGGGTTGACGTTGTAGATGCGGAGCGTGTTGAGCGTCCCGTTGAAGTCGGTGACG
GCGCGCGCGATCGCGGCCTTGGAGTTGGCCGCATAGTTCTTATCGCTCACGTCGTACTCGTACGTCA