Description :
From Genome Similarity Track
Location :
scaffold_43:8943- 10238
Transcript NameFunction/comments
Pl_111288hypothetical protein PHYSODRAFT_537381

Sequence
1295 bases(100 bases per row)
GGCGTAGACGACCTGGTGTTGCTGCCATCCGTGAGCGAGACGTCCATCCTGGAGAACCTCAAGATGCGTCACGCCGCTGACGTCATCTACTCGTATATTG
GCCACGTTTTGGTGGTCGTAAACCCTTACAAATGGCTAGATATCTACGGAGAGGACAGTATGCGTGCTTACATGCACAAGGCGCGCATCGATGTGCCTCC
GCATGTGTTTGCCACGGCTGAAGAGACGTACCGCACGATGCTCAGTGAGGAGGACAACCAGTGCGTCATCATCAGCGGAGAGAGCGGCGCCGGCAAGACC
GAAGCCTCCAAGCAGATCCAGAACTACATTGCAGGAGTGAGTGGAAGCGGCGCTGGGGTTGACAAGGTGAAACGCACATTTTTAGAGAGTAATCCGCTGT
TGGAAGCGTTCGGCAATGCTAAAACGCTGCGGAACAACAATTCCAGTCGGTTCGGGAAATATTTTGAGCTGTTGTTTGACTCGGCAGGACGACCGCAAGG
AGGTAAAGTGACGAACTATCTTTTGGAGAAGTCGAGGGTAGTGAAACCTGGCAAAGGAGAGAGGAACTTCCACATTTTCTACCAAGTGCTGGCTGGATTG
CCACCTGCAGCAAAGCAGAAATTGTATTTGGATCGGGGTGGACCGGAGAGTTATCACTATTTGAAGGCTAGTGGATGCTATGATGTTGACGATGTGAATG
ACGCGCAGGAGTTTGAAGAGACTATGGCGGCCATGCAACATGTGGGAATCAAACGCAAGCAAATTGAATTGGTGATACAGACTCTGGCAGCAGTGCTGCA
CATTGGTAACGTCCATTTTCAGCCCGAAACAGTGGGAGATGCAGAGGGTTCCTCAGTACGCGATCGTGAGAGTTTGCAAATTGCATGCGAGCTGCTAGGA
CTTGATGCTGCACGTGTGGAGCATGCTCTGTGCTACAAGTTGTTGCAAACAATGGCCCCTGGAGGCAAGATTGAGTCGTATGAAGTGCCGCAAAATACGA
GCCAGGCTAAAGCGCAACGTGACTCTATTGCTAAGGCTGTGTACGACCGACTGTTTGACTTTTTGGTGGAGCGCGTGAATCATGCGTTGGACATTGAGAA
GAAAGCTGAAAAACATGGTGAGATTCTGGAGATTGACGATATGACTACAATCGGTATTTTGGATATCTATGGCTTTGAAATTTTCGACAAGAACGGATTC
GAGCAGTTCTGCATTAATTACGTGAACGAGAAGCTGCAACAGATCTTCATCGAACTAACGCTGAAGAGCGAACAGGAAGAGTACGCACGCGAGGG