Description :
From Genome Similarity Track
Location :
Scaffold_35:8942- 10001
Transcript NameFunction/comments
Phyca_LT153462630pol protein

Sequence
1059 bases(100 bases per row)
gccttcaagcccggcgccgcgctctcgcgagctgcacacgcctaatccgttcccgacccgtgatggttcggcgaacgccctgcgcaatgcgcctcctctc
tcctcgaggtacgaggacgagctccctgagccaggtgtggtctccaacgacctggacggggctcaaagcggcagcttgaggctgcatctcgcgtacggtc
gaacagacctgtagcccgccccattgtgggcacgtcgcgtcgcgactacggtttctaccgttcctctcctgccgaggtcgttcggcgcgctgcctcgcag
ctcttggacacgtatacgtgtgggccagcgcctgagacgactgatgaagtcgtccaacgacaatcgctccgtgaccgcttcttgactccgcaagtcacaa
ctccttcggagtaccgtgtgcgcctgcgtcagcagctcaacgatgaggccgtgccggccatgcgtactgtgccggtggtcctctcagagggggaaactac
ggccgcttatgaagcgcagtttcaaaactgggtggagctatcccgacggctccactcctacgatgctctccgagctagtttctcggaaacagatatccgc
ttagagcggcgcttgcgcctcgacttcgcgaagcgacaagcaaaacggcgtgtaccgggacaacgtccctcacgctacgatcaccccggcctcctgctct
cgctgtgagcagccctacccatagccatggatcggctgttacggccactggtcaaagcctgaactcggctattgacctgtcatcaccccactctagtggt
gggaagcgcggcgcgcccggcgactccgtcgcacgccctgcgggcggtccgtcactgggtgacgctgatcataagcgtcaacgacgtcagggcaatcttg
ccgcaatggcacctcaaactcccatgagttctgggaatgagggtaacctcgccattttaccagatactggttttgaccctggcgcctgcgccgcaccatc
aggcgctccacgtgacagtggagatcgccatgctcaccaagcagagccggaggaggccg