Description :
From Genome Similarity Track
Location :
Scaffold_186:89419- 95113
Sequence
5694 bases(100 bases per row)
CCACGTCACGGTCGCCGTCGTCAACGGCGCCGCCGTCGCCTCACGTCGGATCCGAACTTCGCTCAGATCGACTTCGCTTCAAGCGACTCGAAGTCCAGGG
CCCAAGCTCCTCCGACAAGGCCGGTGGAAGAGCGTTATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTT
GCCAGAGGTTGCAGAGATACGGAACCTCGAGGAAATGACAGTTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCCGAGATGGTGCTCATGAGA
CCTGAGACCACTCATGAGAAGCTGAACTCCTCTTCTGTCTTGTACGAGAACGTCCTGGAAGACCTAAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAAA
TCCTTAAGAATCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACGGACCCAACTCCCACCGGATCGAGACGT
ACGGCATGGGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCAATGACCTCTCCCGCGCGAGCAGTGCGAGGTCATTGATGCCTTCTTCGCC
GCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAGTGGCGTCTAGTTCATGC
TTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTAAACCACATGACTGGAGGTGTACTGCACAGTGCG
CTGGATTTGGTAGACGGATTCTACCAGATCCTGATGCGAGAGAGTGACATCCCACTCACCGTGGTGAGCACTTCAAGCGGCATGCTTTGGGAGTGGCTCG
TCATGCCGCAGGGCCTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACATACGTACTTCGACGA
CATATTCATCCATAGCCGTGCCGAGGGAAGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTC
TACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGATCCAGACAAGGTCA
AGACCATAGCAGCATGGCCGATGCCCCGATCCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGG
CTTCGCTAAGCCCTTGTCGGGCCACCTTCAGAAGGACGTCGACTGGCGCTGGAGCAGGAGCACAAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAG
AGGCCCCTGTTCTGGCCCTGCCGGACGAGACGAAACCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTGCTGCAGGCCGACAC
GGCTGGACACAAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAGAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATAT
GCCCTTGTGAAGTTTCGTGTTCACCTTCTAGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCT
CCCAAAGAATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTTTCTCG
GCGTCCTGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATC
GTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCT
ATTACCGGGTGGAGCCCAGTGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATTTGAAGTTTGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAG
CGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAAGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTTAAGACATGTGAA
ACATGTCAGCGGTTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCT
TTGGACTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGTTAA
ACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACGGCTGCGTTTTGGAAAG
CGCTGTTTCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCCATCACAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACAC
TCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTC
AAGCCGTTCTACTTGAACGGCTTCCGTCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTGATCTAAGTGGGAGAGAGGCTCGGAAAG
CCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGA
TGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGTACTCCAACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGTTACTAGAC
ACGAGGAACCTACCTCTTGACACTGTCAGCTTTGTCGGCAGCAACAAGCTGAATCACCGCTTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGT
CGTACACCATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCACAGGGGGTTGCTGACTCGCA
GACCCACCTTGGCCCAGCTCCTCAAAGCGAGGGCGGGCCACAGACGTCGACGAAGGCGTCGGAGCAGGCGCCCAAGCCTCGGTCTGGACGGCAAAGCTGC
GGTCAAGACCGTACGCTGGAGGGGCTCCGTATGAACGGACCCCGGAGCCATACGCCATGTACGCTGAGTACGCCAGGTACGCACCATACGCGTACGTCTG
GGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAGAGCCTCGATCCGTCAGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGTGATCC
ACCCGCATATGCAGGCTCACGACCTCTCGCTCCAATAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCGGCCTGGGCGGCAGCATGGCCGCCAGTCA
CAAGCCCAAGTGCAATCTCAAGCACAAGAACACGTTGACGGAGGCGATCAACCTCAGGGCCCTGTGTCGGACCCGCAGGAGAAGCACTCGGACGAGAGTG
GAGTTCAGGAGGCGCCGAGTACATGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGAGGATCCCCCA
GGAACAACGGCGTCGCGATAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGAC
TGCCCGAAGGCGGTCGCAATCTGGGAACAGAAGCGACGGCAGTTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAAGACACTCC
GTACCCGCGCTCATCGTGAGCGCTGGAAGCCGCACGCTTCAGAATGTCCCTCGGCAGCATGCGCTTGCTGACCAAGTGGGCAAACCGAGCACGAAGATCA
CGCTGGTCCAGGATGCGGGACAGCAGCTGAACTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCATGCCCAGAACATGTCCT
CACAAGAACTCTAGGTTGGGACAGCTCTCGGGCATAGCCCAGGGGTATCCCCAAAAAGGATAGAGACCACCCCGGTTCTCGGGCTTCTTATGACAAGTCG
TAAAGTCCTTAAGGGGGATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAGCGAACAACTGTTCCTTCTGAACAAGGGCACGCTC
GTAAATGCCCCTAGAAGTGTGTCCGCCCACAAGACCACGAGGAGCGACGAGAAGCTCTAGGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATAC
CCTCTTGAGTTGATAGCAGCTCCCTGGCTGAAGGGTGCCACCACCGAACCCCCACACACACGCTGGGCAGCTTGGAAGTCCTCCTGCTGCTGGTCGAGGT
CATTCGTGACCTCCCGGGGTTCAGAGATAGCATCCTCCTCTTCCTCTTCTTCCTCCTTCTCATCCTCTTCATCCGAGGAGTCGAAGAGGCCCCGATGGGA
GTGCCGAGTCTCCTTCTTCTCGCGGAGTGGAGACTTCGAGGCTGCACGCTTCTTTGAGGGCTTGGCGCCTTCGGATTTAGAGGCCTTAGCACGCGCAAGA
CACTCGGCAAGCGAGAGACGTTTGCGAGATTTCTCTTCCTCATCGTCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTTAGAGCGCACAG
ACGCCCTGGGACTGTGATCACCTTGATCACTAGTGAGCGACTGCACGCTGTCGCCCTTGTGCTCGCTGGGCACTGGGCTGTGCCCTCCCGCAGAGCTCGC
AGGAGCATTGTGCGTGCTCTCGGACTAGGCTTCGTCCTCACTTCCAGAGTCGAACTCATGTTCTACGAACCGAGGGTTTGGACGATTGTCTGGAGAGGAC
GAGAGCGACGGGCTGCGGCGCTTGCTTGCTCGCTTGCCCACAGCCTTGTCGCCCGATGAGCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTGAAGTG
CTGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGCCACGAGGCATA
GTAAACGGTCGAAGTGGAGACCTAGAAGAAAAGCGCACAGACTGCTGCTCGAGGCGTTAACTGTGAAGTGAGCCTCCGGCGCGCTCGCGCGGCCAAGTCG
ATGGTTTCGACTTTGAGAATGAAAGTTTGTGACGAACACTTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGAGGAGGATGTAACGGGGTACGT
AGCCCTGAGTGTACCCTGGTTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTACAAGGTACCAAGGTCGTCCAAAGCCAACCATTGGTTAATG
ACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAGCTTTATCTACCTATAAATATACTCAGTTTACATTACCATATATAGGTCA