Description :
From Genome Similarity Track
Location :
Scaffold_405:89415- 91888
Transcript NameFunction/comments
Aphin_H310_03795Hypothetical protein

Sequence
2473 bases(100 bases per row)
AAGCAAATCGGTACAATGCGCTTTCCCTTGTCTTCTGCAAACGCAAGCTGGTCGCTGACGAGAGATGTCAAAATGCTCTCGGCCGACAGCACGACGAGAA
AGAGTTGGCACTGGAGAATCGCGTCCTTGGCGGCAACCACGCGCTCCTTCAGCCCCGACACCTACACACCGTCACGATGAACTCACGTCGCCTTGTATCG
CGTGGGGTACATTGGAGTTTGAGTCGACGAGCACGGACGCGCCTCGTTGGCGCAAGTGAAACCGGAGCTACCCCACAGAATAGCATGACGTTCGTCGCAC
CGACCGCCCGCACCAACCTGTTGAACAAATTCGGGGTGGCAGTCGCCGTGCGAGACAAAGATTGAATGCGGTTTGTGTTTCGAGGGCGTGGCGGCATGCA
GGTACCGCGATGACGTGCCGAGGACTGTTTTGGCGAGTCCATTCGCCATGCCATGGGGGTTGCGTCTACGTGCATGCCCGTCAGTCGCATGGCGGCAGGC
GCCTCGACGATGACATTCCCACCTCTTGCCAAGACGGTGGAGTTCAACTTCGTCGCGCAGCCCATCGAGCAAGGACCGAAGCGACTGCGTAAACACATCA
TGGTCCATCGTGAACGCATACAGGCCACTGGTCAGCGGATCGATCGCCTTTTGAATGACACTGCGCTGGAACGGAATGATCTGCCGCGTGAAGAGGTACA
CTTGCAGCTCCTCGGACAACGGGCCGCAGTCGCAATTCACGGCAACGACTACTCAACACAACGCGCGCGCTGACGCTTCCACATGGCGTGAACGATATCG
AGGCCACGTACCCGGAACACTATACTGCTTCGCCAGCGCCAACTCGGACATGCACAAGTTGTGGCGACCATATCCTTCCGAGAGCACGCACAGGACGACG
CTTACGCCCTTGAGCAGGGTTTTGTTTGGCACTACAACGTGTCGTGGTTGGTTAGCAGTACACATGATGTCAGAGTGGACTGCAAGGCGCTAGGTGCAGC
GCTCGCCGCCATCGTGGCCACCATTCGGCCCACGCAGTACGAGTCGTACCCGTCTCGAGCACGGGCCGAAGGTTCACCGAGATAAAATTGGCTTCGATCG
CGTCGCACACCGACTTGGCGAACGCGTAGTACGGTGGTTCGTACGACATGTACACGTCGACGCTGCCGCTCGCTTTCTTGATCGAGTACTGGAGCTCAGC
CGATATGCAACAGTCGATCGCGCGCCGGCCGTCGTGGTTGACCTCGTAAATGTCGGCGCCGCACGCGACAAGTGCGAGTGCGGTGTCCTTATGGCCTTGC
TTCAACGCCAAGTGCAACGGCGTTTCGCCGCAGTACGCGCGGTTGATGTTCAAACTTGTCCTGTCCAGCAGAGCACGGATCGCGTCTTCGCGAATCGAGC
CACTGTGAGCGCCGACATCCAACGGGGTCATGTTGCTGTCGTCCAGACTGGTCGGGCTCGCATGGTACGATAGCAGCGCTTTGATCACGCCGACTTGGTT
GTGCCTATCATGGCCACGAACGTAATTATCACACAAGCACGTCCACCAGCGGAAGAACTGACCGAGCCGCCCAGTGCAGTGGTGTTCGGCCCATTCGATC
CATAAAGTCGACCGTCGCGCGATGCTGGAGGAGAGTTTCCACGACTCGGGTGCGACCCATCACCGCTGCCCAATGCAATGGCGTGCGCTGGTTCAGCCCG
ACATAGTACTCGCCCAGCACATCCGGCTCGACGCCTTTCCGCAGGTAGTACTGAACGGCGGCAACGTCGCCTGCCGCCGCCAACGCATGCAACGGTGTCA
ACGCGTAGTCACAGCCATGATCTTCCAACAACCGCGCAAGCCCCACTCGGTCCTACCCATTCCATCAGGTTCCGCGCCTTGCCCGTGTACTGGAGCAAGC
GCACCAAGAACAAGTTGTGCTGCAGCACGGTCGTCGACATGGCTGTGCCAAAGCTCGGCACCATCAAGTGGTTCGCGCCGTACCCAAGCAGCGCCTTGGC
CGTGACTCGTGAATCCGCATAAAACAACGGCGGGACCGCCAGGTCCTACCGATCGCCGCCGTCAGTCTCCGGCCGAGAACGGGGGACCGAGCTGCCTGAC
CTTGGAAAACACATCCGTCACGGCCACAATGTCCATGTTTGCTTCGTGTTCACGCAATGCGTCGACGCAATCCAAGTGGCCGTGCGACACAGCGACGTGC
AATGGCGAGACCAAAACGTACTTGGTCCGGTTGTGGCGCCGCCACAACCACTGGTACACCGACCCGATCCCCAAGTCGACGCCGCCCATTTTGTCGAGAA
AGTTCTACCTCGCGCCGTCAGGCAACGCCGGCAATGCCACCAACGTACCGGGTTCAACCCTGCTTGGAGCAACACGCGCGCCATCTCGGCATCGCCTTGC
TGGCACGCAATGTGCAGAGGGTTCTTTGTGCGGTTGGCGTACAGTCCGAGGACCATCGCGGGCGTCGCGTACA