Description :
From Genome Similarity Track
Location :
Scaffold_7:894103- 898544
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05301hypothetical protein
Phypa_INRA-310PPTG_05302major facilitator superfamily transporter (MFS)
Phypa_INRA-310PPTG_05303hypothetical protein

Sequence
4441 bases(100 bases per row)
CACATGCACCGCGTGGCCGAGTCGGTCATGACTCAGGGACCGGAGAACGAGTGTGTGGAGCTACAACCAGAGGGTCTCAACGTCCATGGAGATGAGAACC
CAGTACGCTATTCGTTCCACGTTCCGCCATTCAACAGCATCGATCACGTGCACATGCACGCGTTCCACGACGACCCTCGCAGTCTTGGCTACTACGGCCG
CCTGAAATACCGCACCGAGTCGTGGTGGTGTCGCTCATACGACCAGGTGATGGCCAGATTAACAGAACTGACCGACGCCCAGCATGATGGAGCTGCCGAC
CTTGAAGACTCATCCAGCTCGTCCGGTCTTGTGTCTGAGGGGCGTTTGACAGCGTAAAAAGAATCTAGGCACCTATTTATTTCTGTAAAATCCAAACTTT
TGGGTCTCCTATTTTTAGTCGCTGCTGCCGTATTCAAGCCGCACATTTGAAGAAGTACTACGGCGAGGAGTAGCAGGTTGCCATCCGCATAAAATGGCTT
CAATGTCCTGAAGACTGCGTCGACTAGTCTCGGGGATGTACCAGTAGGACAAGACAATGCCGGCGATGTTGCATGCCATGACGATACCGACGCAGAGGTA
AGACACCGAAACTGGAGACAGCGTGAGCTCGCGTAGTACTGGGAGGGCGTGTGCGAGTCCGATATTAACAATCGCCTCACAGATCACCACGAGGCTAACA
GCGCCCATACGCTGCTTCACGGCGAATAGTTCGCTGACCATGATCACAGGAACAACACCCAAGCCGAGCTGGTGTCCGGCATTGACCAGCAACATGGCAG
CCCAGCCAGAATCGCTCAATGCCACGCCGCTGTCTTCCTCCTGATGGACATTTCTGAAGATGGAGACCAACAGGAAAGCGCAGGCCAATGCCACCAAGTA
GCAGCCACACTGTAGCGTTGCAGGTCTTCCTCTGGTATCAACAAAGTAGAAGCAAGCAACAATACCCATCGCTGCAGCCACAGCAACAGCCATAGTCACA
GCGATTAGTCCAGCTTCAGCACCTTCAACGGCAACTCCAAAGATCGTGAGGACAAACGAGACGTTGGCGTGTGTTCCTCCAACACCTCGACTGCTGTCTT
CAGCAAGCCTTGAAGTAATAGCCGGCTCGAGCAGGAACGCACATACAGCTCGCAACGTATAGAGGGCAGCGCAAAGAAGGACAGGACGATAGAATGCTCC
GTGGTGACGTCGCTCCGTCGCTGCCAGCACCTTAGCGTGGATAATAGCGTTGGTCTCGTCCTCTGCGACGTGTTCGTCGCGGTTAAACAGTTTGTACAGT
ACTTCAAAAGCAGCTTCCCGGTCGTCGTGGCGAGCGATGAGCCACGTAGGCGAATCCGGGAGTTTTTGCGCGAATAGTAGCAGTAACAACGCAGGAGCGA
CGCCAGACAACGCTAGCACCTTCCACTCACTAAGGTTGAAGCCAATATACTGTCGACTCAGGTACATGAAGAGCGCTCCCAGCACCAAATAGCAGAGTCC
TCCGACTGCAGAAAGGAATAATTGTGCACAGATCACTCGTCCACGAGTGTGGGCAGCGCTCACTTCCGCTAGGTACACGGGCACGATCACAGAGGTGATT
CCAGCCGCTGTACCAAGCAAATATCGTCCGATCAGCACCGTGAGCTCTCCATAAGCAACTCCAACCAGCACCCAGCCCACGATAAACGGGATGGCAGCTA
GCTCCAACGTGCCAGCTCGTCCCAGTCTATCTCCAAAGTATCCTGCACCCGCAGCTCCCAGCACGGTGCCTAGATACAAACAGGAGCGGAAGAAGAACTC
GGCGTGCTCGTGTTTGGCGCGGAACACGTCCACCTGCATGTTGTAGAGACGTCCGGGGGCAATAGGGAACATCGTCAGCCACGCACATGCCACACCCGCT
GCTCCCATGGCCGCTACATGTAGCGCGAAGAAGGAGTTCCGCTGACGAGCCAATCGCTTCTGGCGATATTCAGGTCTGCAATACAGTTACAGGACGCGTC
AGTTGCAAGGTGATAAGGGACAATTAAGATGCGGACGGACCGGGAGTTGATGGGGGTGCTCTCATCGCTCGGATCCGATGAGTCCGAGAGCTCCAGCGGT
GCAGAGATGTACTGGTGTGGCACGAAGGCGAAGTCGCTGCGAGGAGGGTCCCGCAAACATTCCACGATGTAGCGCCAGCTGCGCGGACGGCGAGCGACCA
TGACGAAGTGCTCACCTTGAATATAGGCGACTGGTGCTGATTCTGATCTAGCTCAGTTAACGTTTGGCTTGGAATCACTATGCATGAAAGATACATGGGA
CAGATTTCGTCTATATGGGACCGAAAACCATGGTCAAGTGGTTGAAGTCATTGATCTATCTACGAGGACTGCGAAGTAGAGGGCTTGGCTGCTGTCTCGC
TGGGGTATTTTCGCGTCAACTCGCTGCCCAGATGTTTCTTCCAGCGGAATACGCTCAAGCACGAGTACAGGAACGACTTGACGCGGACCTTGGCTGCCTC
CTTGCGTGTCTTGGGGAACGGCGTCGTGTCAAGGCAGACGACACCTGGTAGTGAGAACATATCACTGTATCCCATGCCAAAGACGATAGCACCGGGACCC
CACTCCTTCACATAGTTCGAGAGTTGAGTTGAGATCAGTCGCTTGCTCACAATGTGGGCGCCGTAGTAGTTCTTGGCGTCGATCCACCGGATGGGCACTC
CGTTAATAATCACGGGGTCTAGCAGCAAAATATCCGGCGAGATGACACGACGGCCATGGGTCTCAATCTGATCTGCGCATAGCTCCGCTTGCGTTCTGCA
ACAACCACAAATGATTAGTACAGTAATATGATAAAAGCTTGCTGCTTGATAACGTACTTTAAGCGGATTCCCTGGGCCTTGAGGAAGTGTTCAATGGCAC
GCTCCAACGAGTCGGCATTGTACTTGGGGGCTCCAATTAACGGGTCACTCTTGTGAATGCTGTCGTACTCGATAGCCTTGCGCAGTTCATGCTGGTCGCG
CTTTGAGAGCTTCTCAGAGGGTCTTGCCAAAGAGTTCTACAAGCGAGCAGCAAAAGCTTAGTTTTAAACACATTAGTTAGACAAGCAGACAGAAAAACCG
CATACCTTGATTTGAACCTGGCTCAAGCCCTTGGCGCGAAGGATAACTCGCATAAGCGACACAGGCGGATAGTTGTGTACTGTCGACAGCTCGATTAGGC
TGCGGCCGCTGTCATACTCCTTGCTGATAGTGTCCCTGTCACGACGGACACGATGCGTGTTAACCAGCAACGACATACGCAGCAGTTGTTTGCGTAGGTT
GATGGTCATGTTGGTCGTGATAGGAAGCATCTCCAGGAGTTTATCGATGTGCTTCACTTGCTGCCGCTTTAACCGACGGAATGTTTCTTGCTGAAGTAGC
AGACCTGCTGCCTGAGTCTCCAAAACCTGAGGGGTCGGAGCCACAGGCCACTCCAAATCGATCGGTTTGAGATCGCCAAACTTCTCCCTTGCGTTCTTGA
TTGCCTGCTTCGTTATAGTCTGGTAACTCGGTCCATTCTGGTACACAGAAGCCTGCATCGACGAGAACACCGACGACATCGCAAAGCAAGGGTCTAGTCC
AACTGCACGCACTCCCTCCATCACCGTCAGAGCACGATCCTTACGTCCAGACTCCAGCGAGGTGAGCGACATGATCTCCGGCTCAACTTCTGACAGTCGC
ATCTCCATCAGAATGTCGAAAAACGCGTCAGAGCGCCACACAATTGAAGCACGCAGCAGCCAGTGCATGTATGTGTGCACTGAAATCGGGCGTAGTAGGC
GAAGCTGCTTTAGAACCTTCACAGCACCATCCAGATACTCCTGGCGGTAACAAATATCGAGAAAACGGTTGTAATCTGCCAGTTCCAGCTTCATACCGGC
CTTGTCCATCAGATCCCAGAGCTTAATCACTTCTACAGCAGCCGAAGCCTTGTCACATGCATGGAACAGAGTGCGAAGCGTAGACTCGTCCACTTTCCGC
CCCTGACTAAGCATATCCCGGACAATAAGAATACCCTCCGCTGGCTTTTTCGCTTCGCAGCACGCTAACACTCCAGGGGTCAAGAAGTTTTCGTCCAGAT
ACGGATTGCCAAAATTGCGGTACAAGTCGAAGAGTTTGTGCGCATTTTCGAACGACACCCGACGGAGCTTCGTGATCAGAGACGCAATCTCCTTCTCACT
CGGTAGCGTCTTTTGCAACGCAGCAATTTCTTGCAAAGTCGTGGTAATTTTCTCTGTCTTCAGACTCTTTAGAGGCATAGGTTCCTTGGCCGGCACCACT
GCAGTCTCGGTTGAAGGCTTTTCCGTTGAAGTGTCGCTCTGCTTGTCGTTCTTCGGGGTCTGTGTAGATACAGCAGCTGCTGCTGTTTCCTTAGCGTCAC
CGTTGATTGCTCTGGTCAGCATCTCCTCCTCAATCTCCTTC