Description :
From Genome Similarity Track
Location :
Scaffold_514:894- 4577
Sequence
3683 bases(100 bases per row)
GGAAACCAGCGGGGCGGGCGCCTGATCCGCAGCGGACGCCAAACGCATCGGCACCGCGCAACGGCTGCCTGAGCTGCAAGGGTCCTCACTGGGTCAAGGA
CTGCCCCAATCTCACGGAGGCGCAGCGCAAGGAGATGCTGGACCGCCTACAAGAGAAGAAGAACTAGCCTCCTGGTGGAGGAGGCTCGCGTGCGCTGCAC
GTTGGCCTAGACGCTGGGGGTGCCGAAAGCACGCAGGTGCTGCTGAACGGCCTGGTTACAGTGCCACTCATCGCCGACAGTGGATCTGACTGGACAATTG
TCCCATCGGCTGTGCTGCAGGAGCTCCAGGCACTGCAGCCGGAGCTGCAGGTCAAGCGTCTGCCATCTCCAGTGGTGACGAGTCTGGCAGATGACACGGA
AGTGGACTGCACGATGAGCGCATTGCTAGACTTACAACTGGTGACCAGCGCTGGTGTGGTGAATGCGGCAGGGGTGGAGTGTCTGGTGATGCCGACGAGC
CGAGAGGAAGTTTTGATGGGCAACACAACACTGCAGGCGCTTGGCATCAATGTGGATCAACAACTGGCACGGCTGGCTCAGACACCGGCTATCGCCGATG
AGGTCGACGAATTTCCAGCCATTGAATATGGCAATGTGAACCATACTGCAATTGACGATGCACTGGGTGAAATGGTGCTGGGCGCAGTAAAGGAAGGTTT
CGACGACGCAGAGATGCATAGCCCCCGCGAGCTGCTACAAACGTTTAGGTACACGTGGCGTGATAAGCTGGGACCAGATCCGCCAGCGAAGGTGGCCCCA
TTGAAGATCACGTTACGGGAGGACGCCGTGCCATATCGTTGCCACGCTCGCAAGTACTCGCCAGCTCAACGTCGCTTCCTTCAGGCCTATACTCAAGAGC
TGGTAAACTTCGGTTTTGTTCGGCACAATGACAGGTCACGGTGGCCGTGCGCTGCAGTGCCTGTGCGCAAGGTGGGCAGTGCGGACAGTTTCCGCATCAC
CAACGACTATCGTCCGGTGAATAAGCTAACCGTTCCAATCGCTGGTGTCATGCCCAACCTCGATGTGGCTCTAGATCAGGTCTCAGGATCCAACGGGTTT
ACCAAGTTCAACCTGATGAAAGGATTTTGGCAAATCCACTCCACCCAGACTCGTAAGAACTCATGTCTTTCATGACAGAAGACTCGGTATTTACACCGCT
TCGTGTGCCTCAAGGCGCCATGGATTCGTCGGTCCATTTCCAGAACCAACTCCAAGATGTTTTTCGTGAGCTGTTAGGTAGTAGGCACTGCCTCATCTGG
ATAGACGACATCATCGTCTACGCGGCGTCGGCCATGGGGTTTGTTGCGGCTCTGCGCCGTTTTTTCGAGCTGATGCAAGCGCATGGCCTCAAGCTGAACG
TGACCAAGAGTGTCATCTTTTGCAAGGAGGTGACGTGGTGCGGACGTCTGGTGTCCGGAAATGCAGTGCATCACGACCCGGTGAGGCTGCAGGCTTTGTC
GGATCTCCCGCCGCCGCCAACAATTGCTGCACTACAGCAGTTTTTGTGCGCGGCGAATTGGCTTCGATCATCACTGCTAGACTACGCCAGAGTTGCTGCC
CCACTGACCACGAAGTTAAATAAGCACCTGTCGGATGTAGGTCGACGCAATCGCAACGCACTCCAGGCCGGCATTGACTGGACCGACCCTGAGTGCTTGG
CTTTCGAGGCGGTCTGCCGGCTAATTGCCTCATCGGCCCCGCAGCACTTCCCCTCTGATAATTTCGATATCGTGGTTCTGACGGATGCTTCTCATGGAGG
GTGGGGACTGATAGTTTCCTAAGTGAAACACTGGAATGAGAAGCTACCTGTACACGAGCAAGTCCACGAGCTCCTAATCTGTAACGGCGGTCTCTTCAAA
GGGTCCTCGTTGAACTGGTCGATCGTCGAGAAGGAGACGTACCCTCTGGTCAAGGCCTGCACTGACCTCGAATACCTTCTGCAGCGCAAGAAGGGTTCCG
CATGTACACGGACCACGCAAATCTGATGTACATATTCAACCCTGCAATGGAGATCAAGCGCCACGTCAGAGACAAGCTCCAGCGGTGGGCTATGCGCCTG
TGTGGGCTCAGGTATACCATCGAGCGTATTGATGGGACCCACAACGTGTGGGCTGACATGGTCAGCAGGTGGGATCAATCAGCCAAGCCGCAACAAGCAA
CCCGTTGCCTCGCTGTCCGCACTCGCAGCGCGCCAGCTGTGTCGGTGCTGTGTCCGATAGCAGACCCTAGCTTTGAATGGCCTCGACTCTCTGACATCAA
GAGATGCCAACGGCAGCATGCTGAGGTCCTACGCGGCATGCAACACGAGCTGCAAGATGACATCGTCATGGTGGCTGGGAAAATCTGGATACCCAATGGA
GCCCGGGAGCTGCTCACTCGCCTCATGGTCATAGCTCACTGTGGTAGCCACGGACACAGAGGCGAGAATCCCATGACGACGCTGCTACGTCAACGTTTCA
ACATCGATCGCCTGGCATCTAAAGTGCAGCAGTTTTTGAAGGGATGCCTGCTCTGCAAACACATAAAGGGTGGCAAGCTAGTGCAAAGACCATCGGAACC
AACATTCACTGCTGAGCGATGCAATGAAGGGGTCCATTGGGACTACCTAAGTCTTGGACAGAGTTTCGGCGAGAACAAGTACGTCCTGGTCGTGAAGGAC
GCTCTCACTCACTATTGTGAGATTTTTTCCAGCGCATCTGCCTCGGCATTTGATGCAGCTGAGGGCCTTATGGCGTGGTACATGAGGTATGGCAAGCCCG
AAGTCCTGGTGTCAGATCAAGGCTCCCATTTCCACAATGAGGAGATCGAGTTGCTGTGTGCAAGACTGAAGGTGCAGCAGTCGTTCACACCGGTGTACTT
GCCCTGGATCAACGGAACGATCGAGACGGTGAACAAGGATGTGCTTCAGGTACTACGAGCGCTCCTGATCGAGTACAAGCTAGATGCGAAGGAATGGCCT
TATCTCTTACCGGTGGTCCTAGCGAACATCAACCACACGCCGGTGGAGTCTCTCGGAAACCGATCGCCAATAAAGCTTTTCCTTGGACTACCGGCATCAT
CCGCACTAGACTCCGTCGTGGCGAAGGTGGATGAAAAGACGGCGATATTGTCTGGGAGTGTCGGTGGCGACGCTGCATCCTACATCGAGAAACTGCGGCG
GGCGGTGATGGAGATGCATAAGGAAGTCACAGACAGGAAGGAACGCAAGAGGCTTCAGGCGATGGTGAAGTCACGAGGCGTGGCGTGCAACTTTGATACC
GGCGACTACGTGCTTTGGTCAAGGGTCGACAAGCGAATCAACACGCACAAGCTCCTCGCTAGGTGGGTCGGTCCCTTCAAGGTTGTGCAGCCTCTCCCCA
TGATCAAGCACCTCATTACTGGTGTTGAGTATGAGGTGCAATGTTCAAGGCTGAAATTCTACAGCGATGCCAGCTTGAACATCACGGAGGAAATCACGGA
GCTGATCGCGAACCAAGGCATGCTGCTCGGAGTACGTCAGCTCGTCAACCACCGTTTCAACAACTTGCTGCATCGTTGGGAGTTCCTGGTATCATGGGCT
GGGCTAACCGCCATCGAGGACTCATGGGAATCGGCTACGGACATGCAGAAGGACGTGCCTGTGAAGGTGAACGACTACATGGA