Description :
From Genome Similarity Track
Location :
Scaffold_419:89391- 96069
Transcript NameFunction/comments
Aphin_H310_00860unnamed protein product
Aphin_H310_00861Hypothetical protein
Aphin_H310_00862TATA-box-binding protein, putative

Sequence
6678 bases(100 bases per row)
ACGATGCATCCGTATCAAGCCGTGATCAAGCCTGGTGACCGCCTCGTTTGCTTGAATGGCCAAGCCTTGGAGCACAAATCCCTCGCTGAGGTACATGACA
GCTCGCGTCGATGCGGTCTGTCCTGATGGCATACCAGGTGATTCGACTCCTCATTGCCTCCAACGATAGCCCTCGGGACCTGACGTTTTCACGCACACCG
CCAACGCTTGTCCGTGGCCACTACGACGTCGGGAAGGTTGTCCAAGTCGAAATTGCCCCGGGTCCACTAGGATTACACCTCCATCAGGCAATTCGCCACT
GTGCCTTTGTCGACGAAGTCCTCGACACAAGTCCTTTGAAAGGACTCGCCCATGTCGTGCATCGTGGGTGTCGACTCATTCGCATCAACAAACACGAAGT
GTCCACGATGCCGCGTGAGGCCGTCGTTGCGTTGCTAGCCCAACTCAAGGACCAAACGAAAACGATCGAATTTTACCGCATGGCCCCGGCCACGTGCTCT
GCGTTGGTTCAAGTTGATATATCAGAGGGAGATGGACTCGAATTGGACGGTTTGACAGTGGCGACGGCCTCCTCCGTGAACGGCCTCTTGGTCGGCGACG
TCGTTGCAGCTGTGAATGACGTGGATATCACGACCCTCGACGCCGCTGCTGGTCTTGCCGTGTGGAACAAGGCGCCGTTCCCCAAGCGAGTCATGTGCTT
TCGCGTCAACAAAATGTCTGATGGAGGCACACCAGTTCATCAACCTTCGTTGTCGGTTCGACCAACAATGCAGCCTTCTCCAATTCACCAAGCGTCCATG
CCTGACCCGTTGTCCAAAATCGAAGTCACGATCGCTGACGCCCAGCTCGGTCTGAATGTGGATACCGGCGAGTTGAATTATCTTCGCCTGACCGGGTTTG
CTACCCCAGCCGACGCCCAAAGGCCGTACTACCAACCGCACCACGACAAGCTTCCAGGACGATGCGTCGCAAGTGTCAACGGCATCGATGCCTCGTCCTT
TTCACGCCATGCTGTACTTGAGCTTCTCGGGAAGTTAGCTTTGGTCCCAAAGACAATCGTGTTTGTCACGTCGGCGGATTTGGCCAAGATGCGTGCTAAG
GCATTACGCGTAACAGTCGAGGTTCCACCGGGCTCCCTTGGCGTGGACTTTGACGGAAACATAACCAGCAGCACCGTCTTGACCGCCTTCCGCCCTGTCG
ACGGCGCCCCCGGCGCACTCGAACGCAGCGGTGTCGTCGACTCTGGCAGCATCCTCGTCGCGATCAACCAGATGAATGTCTCGAGCCTCGCCTTGCACCA
AACCATCGATTTGCTTAAGAAACTCACGGACATTCCTAAGCAGCTCACGTTTGTTCGTGGAGGGGTTGTACACGCCGTGACGCAACCCTTCGTGGACGTT
TCCGTTCCTCCCGGTCCCATCGGTGTAGCTCTGAACAGCGCGATTGCAACAAGCACAATCGTTCAAGCGGTCACTCCTGGCAGCGCTGTCGAGGCAATGG
GCGTGATTGGTCCTGGGTCGATCCTGGTTGCCATTGACGGCTTTGATGTGACAGCATTGTCCCTTGCGAAATCCACCGAGCTCTTGCGTGCGTTGTCTGG
CCATCGAAAAATTCTGTCGTTTACTACTTTGTCCAACAAAGGGTTCGTGTGGCCAGCATCATTTGTGATGGTGCCTACGTCGCCGGGCCCACTGGGGCTG
CAATTCGACAGCGGTACTCCCGACGCCGCTGTCGTACAAGGTTTTGTCCAGCTTGAGACAGCAGCATCTGGAGGTGTGGGCGACGTCCAGAAGCACGGGG
GCGTCGCAATTGGCAGTAGTCTTGTCGGAATCGATGGCGTCGACGTCCGCTCGAAGTCCCTCATGGAAATCTCAGCGATTCTCAAAGACATGGGGAAAGT
CGCCAAGATTCTCTGCTTTTCACCGCCTTCTGACAAGGCCATCTCCCCGCCGTCGACTCCAAAAGCATTTCCCCCGACGACGCCATTCCCACGACAGAAT
TCACTCGAAACATTGCAAAAGCAAATCAATTTGTCCGACGACCAAGTTGAGATGCTGCTGCAGCGTCGGAAAAGTGACATGTCCGACAAGCCGCCTATGG
TGCGAGTAAGTTTGAGCCAAACTCCCACCGACGATTGCTCATGATACATTACCTCCCTCAGCGCGTGAGCTCACTTTCGTCGAATGCAAGTGCGGAAGAA
CAACCGTCGTCGCCGTCGCGGCTGACTCGGGAGTACCAAGTCCGAACGGTATGCGGCTGACACTGCTGGAATGACGAATTTTCACAATCGAATCGTTAAC
ATTCGTCTAGTTCACGTGGCTCGGCAAGTTGAAACCACAAGTGCTAGTTGTGGACAAGGACCAAAAGAGCCTGAACGTGCATGATTGGGATGGAAAGCTC
AAGTCCATGGGTTTCTCGCGCTTGGCCATTGCGTCCATTACAGGAGTCACGAAGGGCAAGGGAGGGTTCAGCAAGAAGCACTCATGGCCGAACATTGACG
ACAACTTGTGCTTATCTATCGCTGCAGGCAAGTCCGCGTCACACGAGTACATTACCACGTCCATGGAAGACCGGGATGTCTTGGCAGGACTGGTGGAGGC
ACTCATGCGGACCACCTCGGCGGTCAAGTAGCACGTGAAAATGGCATTTTATCCGTATCCGTATAAAACTACAAAAATAAATAAAGTTCGCGATGTTGTT
GGCACCACTTGAAAATACGATCATCGAACGGATCTGGCTGGAGGCAACGCGGCGGTCAACCCCATGTCGAGGAAACGCCGAATCCCGTTGTCCAGGCCGC
CGGAATCGCATCTCTTCGAGGCAGATTACGACTGCTGGGTCAACGTTGTACGTAAAGTAGCGAGCTACATGCAATAACCGCTGATGATGTACGTGTGTGG
ATCTCAATAGGTGCGGCTTCGTCAGTGGGTGTCGTCCGTGGATGAGTATCACGTAAGTTGGCTGAACGAGCCTTGACTTGTGCCGACTCGAATGACCTGC
TTCATGTAGCAACCGCGGCACCAAACGCCCACGCTGCTTCTCGTCCTGTCACCGATCTCGATCATTCTGAAAGTCGAACCGATCATCCACTCGGGTCCAG
TGGTTGCGTCCGATTTTGCAGTCCTTCAGTCGTCCTTGGCTCCGAATTCCCGCGTCTTCTGTCCACTGAAGTACGAAGCTCTTCTTTGCGAAGGGCTGGG
TGCTGCCGCCGGCAGCCTCAACCTCACAATTGTCGGTCGACCAGACTCGGAAATCCCCCTCGCATTTGCCGAAATCGCTGACCAATTCGCGACCAACATC
CCTTCACGCTGCGCCTTATGCGACAATACCGAAGTGAATGTCGCGTTTGACGGGTATGCGGCGCGGCCATGTGTGTGTGCAGGTATGGAAGCCATCCCTG
GTGTGACCGATGCCATCTTGCACTCCATCTTTGACACCTCCAGTCGCTTTTGGGCCGCCACACCGTGGTTGCACATGCGCATCAACCACGTTCTTCGTGT
GGAAGTGACCGGGTCGCCCTTCCGGTTTGTCCAAATCCTCGGTGGCACGGGGTGCTGCGACGTTGCCGTGATGGTGCATACCCAGTGGGACGATGTGCAA
AACGAAAACTGGTCCGTTAGTACGATGCACATGAACACGAAAGGGTGCTATTCTGTCGTGAAGGCCGAGTTTCAGCCTCCTGGCCAGGGCTGCAGATCGT
GGAAGGACTTGGACTACATTGACGCCCAGGCGCGGCTCGGTCGACCGCTTGCCCTCCCCGACCCGGCAAATCCCGACCCCGTCACCCAGCCCGTGCTTCC
ACTGTTCACGCGTATTTCCATCAAACGCAAGTCCGGCACCACCGACTTGGATGTCCGTCAAGTGTCGGCGACGCTGGAAGAAATCACCTATCTGCAAGTG
GCCATGTGGGCAGTTGTCACGCTCCTGAACGATCAGCTGCTTCAAGCCGTGCCGCACTCACCCGTGGGCGATTATCGCAAGTTTTACGCACTCCAGATGA
AGCTGCCTATTCCAGACAACCTTGTCGTCCATGGGTCGCTACCGCCTCACCAGCGCCACGTGTTTGTCCAATTTCCAGCGGTGAACGATGTGTCGGCGCT
GAGTGAATTGCAAGCCGTCGGTGTGGAGCTCGCCCAGAAGCAACCTGATGGTAAGGCGAAGAAGAAAAAGAAGAAGAAGAAGAAGGAAGCGTCCCCAGGG
TCGGCGACGCCTTCCTCGTCCATGGAGCACGACGACGACGACGGCATTGTGTCCCGTCCCCACTCGGACAACGACAGCATGGAAGTGGCAGCGCTCGCTC
GGATGCGTGACATTATGACGAAGAAAGCCTTTGCCAATGCATTTTATCAAAAAGGGCAGTATCTGGAAGCCTATGCTCACTACACGTTGGTCCTGGACGA
GTACCAGCGCTTTCGGGCGTCGTTAGCCCCGCACCACCAAATGGATCCGCAACTGGTGCTCAATGGCGACAACTTGTACTCGAACCGCGCGCAGGCTGCG
CTCAAACTCGAGTGGTACGACAAGACAGTAGAAGATTGTAACCACGTGATCCCTTTCATGGTGTCCCAATGCTCCAACACGTACGTGGCGCGGTGTTTGC
ATGCCCGAGCGCGCGCGTACGCGGCGCTGCACCTGTACGACAGCTCGTTCGACGATTGGCACGTCCTTGCGATCGAAGCCCAGAAGCATGGGAGTGCTAA
AGCAGGGAGATCGTGGTGCGACGTCCCGCCCAAGACGTATTTGGCTGACGAAGGCCAAAAGATTCAAAAGAAACTCGCGGCGTGCACCGTGGATGGGCAG
TGGCGCATCATGGGCACGAGCGGTACCCACCTCACGCGTTTTTTTCACTCGACGGTGCTCCATCCCGACGGGACGAGCCTCGTCGTGTTTGGTGGCCGAT
CGACGACAATCTTTGGCAACGAGGACAACGACACCAACGTCCACTTGTACGAGTTCAAGTCTCAGAGCTGGAAAGACATTGTCGGGACTGGCGACGTACC
CCCGTGCCTTGCCGGCCACAGCGCCGTTGTGTACGACCGGTCCATGTACGTCTTTGGCGGGAGTCCGCTGAAGGATGACGGGCAGCACGACTCGCACGGG
GCGTTTTACCAGCTCAACTTGGACACGTTCGTGTGGAAGCGGTGGCGGCTGCCGAACGAACCGGCCCCCCGGAATGAACATACGGCCAGTCTGCACAAGC
ACCTCATGATCTTGTACGGCGGCGTCACGGCGCCGTCCACCACATCGAGCCACATCGACGTGTTCAACTTCAAGACGAAAAAATGGTCCGTCCTGCCCCA
GCGCATGACCGAGTACGCCCCGCCGCCGTCGCTGTCTCTCCACACTGCCTGGATCCATAACGCCAAGCTTTACGTGTTTGGAGGCAAGGCGGACACAGCC
GACTTTTACGAGTACCAGAACAAGCTGTACACGTTCGACTTGGCGTCGCATTCTTGGATGGGATCACCGCCACCGATTGGGCCGTCGACGCATGCTGCCT
CCAGCGCCTTCCCACCCATCTACCCCGGCCCTCGCAGCGAAAGTCATGCCATTGTGATCGAGAACACGATGTACCAGTTTGGAGGCTACGCCGAGTTGCC
AGTCGGGTCCAAGTACTATGGCGACGGCTACCGCCTGACCCACTACGCCGACAACAGTGTGTCGTGGGCCAAGTTCAACGCATCATCGATGGCGATGCCG
TGGCCGAGCTCCCGCGCTGCGTGCACGTTGACGCTGGACCCACAGCGGAAGCGCGCCATATTGTACGGCGGGTACGAGACCATGCGCAACGACATTGTGT
ACGGGGACATTTGGGAACTCAATTTGGCGGACCAAGCGGCGGTGGCATCCTTTGCAACGCTATCGCCACCGACTGCATCCACGCTGACGGTGTGTGGCAG
TTGCGGCGTCGAAGGCAAGTGGAAGAAATGCGCGAGGTGCAATGCAAAGGCGTATTGCTCGCAAGCGTGCCAAAAGAAGGACTGGCCGACCCATAAAGCC
ACGTGCCGCAGCCCCAGGACGTAGTTGAGTGTCGCATTTGAACGTGAGATAAAATTCGACGCATTCGATGCAACGGATGGTGCTCCGTCGAATCGGCTGA
CGGACACCACTCGTCCTTTGACTCCAGCTAGATAGATTGCATGCCACCATGATGAACTTGCGAGGGCAAAGGTGACGTCGGGTGAGCAACCCTGCCTCAC
AATCGTATTCACATTTGCATTCAACCGAGGAAGAGTTGGCTGCGAGTCGAAATTCGACCCAGCCGCTTCGTCGATCCAGGCAATTCGTGGTGATGGGATA
TTTGAGCTAGGATTTGCCGCCTTGGGGATGAAGGTGCTAGCTTGACGAGGCGCTGGCAGCGTCTTCTACTTGAGGCTTCATATCGCGAAACTCATTCAAT
ATCTGTGGACGACCCGTCCGTCATCGCGCGTCCATTGAAGACGTGGTTTACCGTCGAGATGTTGTCGCAGGCTTCGCGAAGGTGCCGACTCTCCTTAGAC
CCTGTGAAGACGATTTTTCCGCTGCAGACCAACATGCGACGGATAAGTCCCAGGACGTAATGGGGGAAAATGTGTACCTGGCGAAAATGAGGATGTGAAC
TTTGGGCTTGGACATGCGGAAGACCAAGGCTGGGTACAATTCGGGCTCGTACTACCACGAGTTCTCGTTGAGTGGTGT