Description :
From Genome Similarity Track
Location :
Scaffold_8:89386- 90941
Sequence
1555 bases(100 bases per row)
CCCAGGTATTTACTCCGTTACTTGCTTACACTATAGTGTTGAGGAAGCTCGCAATAGGACGACTGAGTCTTAGGTTTAAGGAAAAATCAACTCTGACTTT
ATTTTAGGACCAAGGCCACACTCAAATACACGTCATAGTCCAATTGGCTAATAATGGGTCTGGCTCCCCATATATCAGCCAATGGCATGACAGCATTTCA
GCACACGCTAGTCGTGTGCTGATGCACCTACTTTTGTAAAGAAATCTACCTACTTATGTAATGGAGGGGCCCATTACATCGTGAGTCTCGTGAATGAAGG
TGGCGATGAGATAGAACCTCCATCGGAGGAAGTGACGAATGAACCTGATGCAGTACAGCCTCTTGCGATAGGTATTGTTATCCATACACTTTTGTATTTT
ACGTTACTTATTCATATCGTGTATTCTCGTTAGTAGACGACCCAAACCTTGTGCAGCCTGGTGAAAGACCTGAGGATTTTGCTGGCCTTGATTCGGATGA
CAACACTGAACATGGGTCTGTGTACGACGACGACGATGACTTGGGACCAGAGGAGCCTGACCCTGCTGAAGTTGAAGATACTGAGCCTCCAGTAGATATG
CATTTTGATGAGTCACTTCTCGAAGCCGTTAATGGAGCTGACTCCAGAACAAATCAAGACGTGGCTCGAGAAGGTGGTTGATGTTTCGGGAAGAGAGGTT
TGCATTTTTGTTGGTTTGCTTATCGCGCGGACAATTTGTCCGAACAAGGAAAAGTTTGAGAACCATTGGAAGACCACTGATGAAGGGGCCATTCCTAGGG
GCTGTTTTGGCCAGTTCATGACCAGAGACCGCTTCGCTCACATATTTCGAAACCTACACTTCAGCAGCAATAGTGATCCGCGTGCCGCGTGTGATAGAGT
GTGGAAATTGCGTCCTGTATCCGACACTCTGCAAGAAACGTTCCTGCGCAATTGGATTTTACCGGCAGTGATGGTATTCGATGAAGCTATGCTTCCGTCG
CGCTCCACCTTCAATCGCATGCGAGTGTTCATGACGGATAAATCTCACAAATGGGGCACTAAACTCTTCATGCTGAGCTGCTCGAAAACAGCATATTGCA
TACGGTGAGTAAAAGCGAGCCTTCGGGCTCGCTTTTTTTTTTGGCTTCTAAGTTCTCTTATCGTGTCTAGTACATTTTAACTGACGCTGTGCAACATGTA
TGGTACAGTTTCGAGGTGTATTGCGGCAAACAGCAGCTGCAAGACACAAATACACCACCTGACACAAATTGCGGACCAGCAGCAGTCGTGCGAAATCTTC
GCCATGTATTTGGACCTACTGGACCTCCAAAGTTTCGGTTGATTATCACCGACCGATTCGTCGTCCTTGCAATGCAGTTGCTGACCATGAAGTTCTACAG
TATTGGTACTATTATGACCAACAAACAAGGTTTGTGCGAAGCTATTCTTCCACCAAAGAAGAAGAACGGGAAACGTGCTTCAAACAAGAGGCCACCACAT
ATTGTGAAAGGGACATATCAAGTGGCTGAGTGTCTGAAGGTGCCCACGATCAAAG