Description :
From Genome Similarity Track
Location :
Scaffold_231:8936- 10407
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_231-snap-gene-0.28Protein phosphatase PP2A regulatory subunit B

Sequence
1471 bases(100 bases per row)
TCGCCTTCAGCAGCTGTAAACGTATAGACTATTGCGAATCGCCACCGCGACTTCGTTTTGAGTTGGATGCCAGCTCGTTTGAAGCACTTTCTTGTTGAAG
TCGAGGCCATCGGTCGGTCCTGCAGCTCCTGTTTGACCAGCAGCACAAACCGGTGCATCGGCCGCGGCAGGAGCAACTAATGACTGCGCGATCATCGTAT
GCGGCAGCGAGTGACGTCGACTGGCGTTCGATACACGGGGGTTGGGCGTTAGGCAAATATCGCTGCGCCCGTATCGATCATAAATATGAAATTCGCTGTT
GTAGGAGCCGGTGATGAAGTTATTGCCGTCACCGCTCACTGCACACTCAAACTTGTCGAATATACAATCGCTCTCGTAGAGATCGCTGAGGCGTGGCCGC
AAATGCTCATGGATCTACACGAACAGCAATTAGATCATACTGTCCAAGTGTCCTCCTGAAGTCGATAGATGTACTCACGTTGATAGTTTGCACTGGTCTT
GAGTCCATGTTGATATCCCAGATTTTGAGAGTAAGGAAGTCGCGCGCGATAATGTAGCGCCCATCTGGCGAGAATTTGATGTCTGAAATGgaGGCGATAA
TCTCTGAGAAGAAGCTTCGAGCCTCGGGGTCTTCTGGCTCTTCATACATCTTGCAGTACGAGTCGCAGAGCGCTGCCTGACGCATATCGCCGAGTTTGAT
GGCGCCGCGACTCGTGCTGTACATCATGATGTTGCAATGCGACGGATGGAAATCAGCAGCGGTGATGACTTCAGTGAGCTCCTCCATGTTGCGCGGTTTG
ATGTCCACGATGTCTGTACAATAGAGCGAACGCTGATGGTCAGTTCGTGTTGAATGCCACCTCGTCAACCTCACAGCCACGTACTGAAGCTTTGGTCGGA
GATGGCGAGGCTCCACAAGTTCACACGCAAGTCATCGGCCGACATGAAGGTTTCGCCGTCACTATTGAGTGCGATTGAGTTGATATGGTACGTGTGGGCA
TTGGCATACGTTCGCTTGTTGGTCGACGTCGTGACGCGGCTCCGTACAGCAGTCTGTGGCAGTTTAATGGACTGGATCGGTGGCTTCCGAATGACCCCCG
ATGGCTGCTGCGCCGTGTTGTACTGTGTGACTTCCCAGACGTTCCGTGCATGCACTTTCCACAGCTTGACGGtCTTGTCGTTGGTCGAGAGCAGATACTG
CGCGTCATTCGATGGTCGGCACCATTTGATCTGGTTGATCTTCTCTTCGATCTCGAGGCTCTTGAGGTAGTCGAACTCGGCCTTGTGGCTCACAAACTCG
GTGTACGGTGTGTACTGCGTCGGCTGCATGCCTGTTCCCTTGAGCGAGTCCAGTAGCCCGGAGCTTCCGCGGCTGTAGATGTTCACGCGTCCGCCCTTGT
TGCCTGTGGCCAGGAACTCGCCGGAGCGGTCGTATTCGATGGCTGAGATCACGTCGGCCTCCACGAGGCTG