Description :
From Genome Similarity Track
Location :
Scaffold_6:893548- 895636
Sequence
2088 bases(100 bases per row)
TCACTGCAAGAACCAAGATGACAAGCCTGACCTTGTCATCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCG
TCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGAGGTAAAGATACCTCGAAGTATGTTGGAAGTACGACTGGCAACGGGCGCCG
TCGTGAAGACCGAGAAGCGCATGGTACGCGTGTACTTCACGTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGA
CATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCAGAACAGTGAGC
GATGGCCCTGTTGCCGCTACACACGCACCAACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGA
GAGCACACGCGCAAGAGCAGTAAGCGTCGGCGTCGCCGCCGACGGCTAAAGGAGAAAATGTGTTGATCTCGGAGATCGACGCCCGCGTTTCAGCGAATCA
GGTAGAGTCTCCGACCTCAAGAGGTACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGATTCTGATTGGATCAGTTTTGGCCAAT
AATAAGAGCCAAGGTAACGAAACACCGTCGACTCCGGGAGTCGATGGCTGGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCATCCTCCGTAATGG
GGGTCTCCGCCAATGGTTGGCGTCGAGGTGAAGACGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGACGGTGCGGACGGTTGCAAACGTTCCGCACCGGA
AAAACTTGCATGCTGTCGTGCAGCCGGGGGCTGCTCGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCG
GTACTGAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAGTCATGCGGAGCCGGGCTCCGCAGGACAAGAAGACGGCGCATGCGAAGGTC
GCTGCGCAGGTCTCGGCCTGGGGTCGAGACGCTACAAGAAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTCACG
CGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCGAACCCTCTGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAACGCT
TCGCGCGTGACTTGCACGATGGACGCATCGAGGAAATATGCATTCTCTCGGACACCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTCAT
GGAGAGCACCACTGAGAGCGAGGACACCTCAGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAAACGAGTCCCTACTACG
AGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGATTGATCTCGTGCCGGGGAC
GAAGTACTGTGTCACGCGACAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAA
TCGAAATCCCCGCACAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGTGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATAC
CGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCATGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGATTCTATCAGAT
CCTCATGCGTGAGAGCGATATCCCTCTCACGGTTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGTATGGTCTGAAGAACGCCCCT
GCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCC