Description :
From Genome Similarity Track
Location :
Scaffold_13:89321- 95337
Transcript NameFunction/comments
Phyra_75461Elongation factor 1-alpha
Phyra_75462oxidoreductase
Phyra_71314protein pelota
Phyra_41112predicted protein

Sequence
6016 bases(100 bases per row)
GTAAATCATGTTGCATTGCTTACGTGTATTTCCCTTCTCGCGTGACTGATACATCGACACGGTACTTGTTCCGTCAATTCTGTATTCATCACACGTTCTC
GATATGTTTGAAGCTCGCCGCGTTGCTTTCCAGGTCACTCAGACCGACAGCATCTACCATGCTGTTGGAACCCGATCGAAACCATTCCAAAGCGTATTCT
TTGTTCTTCTGAAAGCACAGGAAAGTCTCTACCATAGCCGGGCTATCTGCCAGCGCGGCCTCGCGCGCAACACCTTCTGTACGCTGAAGCACATTGTAGA
TATTTTTCCGAACAGTCTCGCCACTCGAGGACGCTGCCGGCAGCGACAGCACCATTTCAGCGTAAGGTGCGATCAATGGGAACCGCAGCTGATTCGTTTT
CCACCACGTCAACGGGTCCACGTTACGCTCCGAAGCAGGAAGACTCAGAAAAGCGCTCAGCTCTTTTTCCCAGGTTGCCACCATCTCATTATCTCTTTGT
AATGATGACTTCGACGACTCGGACGGCAGATGCGAAAGCAGATCATCCTCCTCGTCCTCGAGAGACAAGTCACCGCCTGTTGGGCTAGCGGCCTCTTTTA
CCAGCTCTGCATAGGCGGTATCTGCGCCAGACAGCCCTGAGGACCCAGTCGCATTGGACGACTGCGCTACGTCAGGTGTAAACATTCGACGGAGAAAACC
CTTCCCAATCTCGCAATCGGCCTTGGGAGACAAGTAGCAATACTCACGGTTCTTGTAGCGCGGATCGAAGAGCGTCGCCGCGTAGCACACTGCTGGGAGC
GTTGCAAATTGCTCACGCAGCTTCCTTGCCACCGTATCGAAGAAGCGCTTCCACGTGACTGGCCCTAGATGGGATGGCACGCTCTCAACAGCCGATTGTG
CTTGCTTCTCTGCGTACGTCACCAGGGCTGCAGCAATCGTTGAAATACTGGAAATGCCGCTCTTGTTCACCTCCTTGTCGCTACCAGTTTTCTTGTTCTT
TTCTCCTTCTAACGCCTCTGAGTATCGGGCAAATGGTCTCAATTTCTTCACTAGTAGCCCGATGAACTCAACAGTCGGTGCAGGTAAGTACTCCACAAGG
TTCGCGTTCGCAATTTGTTCCAGTGTGGGCAAATGCTCGAGAAAGTCGCGCAGAAACTCGTAATAAGACATCGATTCTTGCCCTTCCGGAAAGAGCTCTA
CGTTGAGAAGTGGGCACTTGCGGCTGAGGGAATGCATCGCTCCTTCATTTTCGGCTAACCGCACCACAAACTCCTCGATCTGATTGACAACCTCAGGAAA
GGCCTTCGCGAATACATTCTGCGTCAAACACACACGCAGGTGCTGCACCGCGGACGTAAGCAGGAAAGTGCTCTGCGCTGCATCGGGCGAGACAAGCCGC
CCATCAAAGTTAACAGGCACAAAAAGTGACGGGAGATCGGCCGCCGTCAGCTCAATCTTGGCTGGCAGCTCATCCTTGACGCAGGCAATCACCTTGTCCT
TTATACCGAGGCGATCGAGATACGAGTCCAGAATGCTCTTGATCGTCTCTAGCCCAGGTGTCTCATCCAGCGGCGCGACACCGACGGCAATATCAAACAG
CCGGAAGTTGACGCTGAAGTGGATCTTCACTGCCAAGTACTGCGTAGGCTTTGGTTCTGTGGGGGTTGGGTGCTGCCACACCTCGAGCGACACCGCCACA
CTCTTGGCCCTCGTCAGCACCATCTTGGTGGTCACGAATACGCTCTCCTGCAGCAGCAAGGCGGCCTTCCCCACGGCCTCTTCACTCGGCAGCGGGAGCT
TCTTCTCTCCTAGCAACTGGTTCATGACGTACTGCATCCCAGGTTTCGTCGTGAAGTTCAGGGGCAGGTTGTCTACCACGGCCATGAGAGCTAAATCCTG
TGTAAACTGTTCGCAATTGACCTGTACGGGCTGCACGCCATATGCCGAGCCCAGCGACTCTCGCTGCTCCTTCGTCAGCACCGGCGGCGGGTACGTATAG
AGCGCTGCCGTCGGGTCTCTTTTGAGTGCAGCGGAGAACATGCTGGGCGAGCCTCCGGCCGCGGCCACAGCGGCAGCCAGAGCCTGCGAGGGCGGCGGGT
ACATGACGAGCTCGGCGCCCGTCTGTTGGCCAACCTGTAACCCGATCTTTTGGCGCTTGAGGTGGCGCTTGGTCTCGCGGTGCTCCTCGCACACGTTGTT
GGCCTGCTGGTGTGTGGGGTCCGTACGCCCGGCCGTGCGCAGGTGCGAGAGCAGGTTGGACGAGTGGTGGCCCTTGATCACGCGCTCGCAAAACTTGCAG
ACGGAGTTGCCGCTCTGGTCCTTCTCAAAATACGACCACACGGCCGACACGCTGGCCGGTCCGCTCGCATGGCCCGCAGGCGTGGACGGCGACGACAGGA
ATTCCGCACTGGCGGGTGCGCGCTTCACCATTTTGGCGGACACAGTAAAACCGGTGCGAGCGGTAAGTGGCGAACCCGGAAATGCCGCACTAAATGAGAT
GTCGCCCTGCCTAGAGGGGACGCGTCGTCTCTCCTGGGAATAGTGACATATATCCTCAAAAGAGTGATCTAATACTGCAATCATTCAACCTAATTAGTAT
GAAACAATGTAGGGATCTATCGATGATGAGCTTGAAGTGAGCTGGTGGTATCCGAAGTCGCAGTCCAAGTTCTCCACTGCACGCACTTCCCAATTGATTC
ATCGGAACATGCTGCGTCGAATCTGCTCCCGCCACTGTGGCCCGATCGGGCGTCGACGCTTCTCTGGTTGGTGTTTCCTCTACTGTAGGATCACCGGCAG
TGCTAATCTCTTGTTGTGGTTGCTGCCAGTAGCTTCCAGTAAAGCGATGTCGACTGTCGGTTTCATCGGCCTGGGGAATATGGGCTTCCCTATGGCGCAC
AACCTGCTGAAGGCTGGTGTCGACGTTCTGTGCTTCGACGCCAATCGTGCGGGCGTCGATCGTCTGATGTTGCTCGGAGCGAAAGCCGCGACGTCTGTCG
AGCAGGTGGCTGCGCAGACGAACACCATCTTCTCAGTGCTACCCAACGACGAGATTATCACGAGCGTGGTGCTGGGAGACGGAGCTAAGCCTGGATCGGG
CCTGCTGGCTAACATGGCGCCCGGAGCGCTGCACGTCGGCTGCTCCACGATCCACCCGAACACGTCTCGATCTCTTGACGCCAAACACCGTGAGACAAAG
ACGAGGTATGTGGCAGCTCCAATCTTTGCTCGTCCAGACGGCATGGAGGCGATGCAAGCGAACTTTGTCGTGTCGAGCTCCGACGCCACCGCCGTGGAGG
AGGCCTCGCAATGGCTGGACAAGTGCACGAACGGACGTGTGGCTCCATTCAGCACGGAAGACCCCGGCGCAGCAAACGCGGTGAAGCTGTGCGGGAACTT
CCTCATCGCGACCGCTATTGAGTCGATGGCTGAGGCACTTTCACTGCTGGAAGCCAACGGCGTGGACCGTGTGCAGGCGATGCAGTTCTATAGCAGCACG
TTCATGAACTCGGTGATCCACAAAGGGTACGGACAGCGTGTCTCCGAACGTGACCATCGTCCTGGAGGCTTCGCACTAGAACTGGGCTACAAGGACCAGC
GTTTGGCGCACCAACTGGCGATGGAGTCGCAAGTGCCGATGCCATTCCTGTCCACGCTCATCGACCGCTTCCTGAGCCAGCGCGCCAAAGGCCGCAGCGA
CCTCGACTGGTCCGCGATTGGCCTCGGTGTCTGCGAGTCACGTGGCGTCGACGTCTCGGATGCTATTGACCGCTCTCGAGCGGGCCAAGCGCCACCACCG
TAAGACAGGAAGAGTGTAGTCGTGTTGGAGTTACCACCGTGTTTTGAGACAAGTTGAAGTCACTTCGCGTCGTCTTTGGAGAAGTTCCTCTGTGAATGTC
ACTATTCTGGGATCCTCGTGCCAGGGGCCATTTTGGCAGGACGAAGGGCCAAGATGAAGCTGCTCAAGAAGCAGATCAGCGAGAAAGATGGCGCCGGATC
GGTGGTGCTACGCGCCGAGGAGCCCGAGGACATGTGGCACATCTACAATCTCATCCACGTGTCGGACTCGGTCAAGACGACGACGATTCGCAAGGTACGG
GGCTGCTCTGGTAATGTGGTATCCTAGTATCGTACTTAAGTGAGGTATTGGCTTGCTACTGTGTCTGCAGGTGGTGAAGGAGGGCGTGACGGGGTCTACC
AGCAGCCAGCGCGTTCGCATGACGCTGAAGATTGAGGTGAGGCCTGGTAGCTGCTGGAAAATGCTGTGGGTGGACTGAATGCTGAAAATCGACGTGCAGG
TGGAGCAAGTGAACTTCGACCCGGCGCTGTGTGTGCTGCGTATCAAGGGCAAGAACATCATGGAGAGCCAATACGTTCGGGTACGCGGGTTGTAGTAATG
TTTTGTGCAAGTGATAAAGCAAGAAACTGACAGAGTTTGTGTAGATGGGAGCTTACCACACGCTGGACCTGGAGATGAATCGCGACTTCACGCTGACCAA
GAACTGCTGGGACGTCATGTCGCTGGAGCGGATCGACATGGCTTGCGATATCACCAAGCAAGCTGAACTGGCGGCTGTGGTGATGCAGGTCGGTCTGGCG
CACCTGTGTCTGATCAAGGGTGATATGACAGTCATTCGGGCCAAGATTGAAACCAGCGTGCCCAAGAAGCGCCCGGGAAGTTCGGCTCACGCCAAGGGCA
CTGAAAAGTTTTACGAAAACATTGTGCGATCCATTCGACAGCACATTGATTTCAAGCTTGTCAAGTGTGTGCTGCTGGCCAGCCCAGGTTTCGTCAAGGA
CGACTTTTTCAAGTTCATGGTTGAGCAGGCTGTCCGCCAGGACGACAAGCTCTTTTTGGAGAACAAGCCAAAGTTCGTGCTATGTCACTCGTCGTCTGGC
CACAAGCATGCTCTTGACGAGGTGTTAAACGATCCGGCAATTCAGTCGCAGGTGGCAAATACCAAGGCTGTAGAAGATGTCAAGTGCCTGGAGCGCTTCT
TTAACATGCTGCATATCGACCAGGACCGCGCATACTACGGCTACAAGCACGTCGTCCAGGCCAACGCAAACATGGCCATCGATACGCTCATGATCACGGA
CGCTCTCTTCCGGTCGCAAGATATCGCCACTCGGCGCAAGTACGTTGACCTTGTGGAAAGCGTGCGTGATAATGGCGGCACGGTTCGGCTCTTCAGTAGT
TTGCACGTGTCAGGCGAGAAACTAGGCCAAGTCAGCGGCATCGCTGCAATCCTGCGGTTCCCAATGCCTGAAATTGACGAAGAGGACCAAGACGATGAGT
CTGAATCAGAAGAGGAAGAGGAAAAGGAGGACGACAGTGGCGTGGGAGACTTGTCCGTCGAAGCTTTGGGTATGTAGAGACGACAGCGGTTATCAGAAGA
TAAAATGCACGCGATGCACAAAGCAGAGAAAATTCCACTTAGCTGCCTGTGTTGTGCTGTACGACGAGGTTGGACACTCGTTTGTCAAAAGTCTGCGACG
TGAGGCGCTCTCCCAGCGGCGCGAACGGGTTCGACATGGCGTTCACGTACAGCCGATGCACCTCCGCGAAGAACTGGAGTCACACACCGCCATACACAAG
GTCAAATCAACCCCCTAGCCACCATGGCAATTGATTCAAGAGCTCACCGGTCTTAGCTCCGACTCGCGTACTGGGGCGTCCTGCAGGACCACCACGAACT
TGACTGAAGTGTTGGTGACGTATCCGTACACTCGATAATCTTCGATGGGCCCCAGGAAGCCCAGGTACATGTCGTCCTTGGACGTGGTGACGCTCGCGCC
GCGCAGTTTCTCTTCGATGACGTCCAGCGACACGTGCGCGATGTAGTGGAAGCCCAAGTCCTCGCCCTCCTCTCCGAACGTGCGGATGTACAGCGGACTA
TTCTGCACGGGAGGAAGCGGGAAAAGAGGACTATACGTCAGTACGGACTCTCGAGCCTTGGAGACAGACACAAGACACGCACCGCCGCGCCGATGACCGC
GACGCAGGCGATCATG