Description :
From Genome Similarity Track
Location :
Scaffold_5:8930- 11977
Transcript NameFunction/comments
g2720.t1hypothetical protein

Sequence
3047 bases(100 bases per row)
CACAGCTTGATGTTGGCCACCAGCACCACCATTGTGAACGCGAGCAAGCCGTACTGCACCATAGGTGCGCTGCCCGCATTGGAGAAGTTCTCGTTGAACG
CATACACGACGAACACAAAGATGACAGCGGATTCGTACACGGCACTGCAGATCCACTTGAAGAACGTGTAGTTGTTGAAGAGCTCCATGCGCGGGCCAAC
CAGGTACAGCTCCGGGAAAAGTCTGCTCACTTCAAAGGGCACGTCGTAGTCGAACACGCCCAGCACGATAATAGGCAGCGAGGTGTAGCAGATGTTGTAC
AGCTGGAAACCCAACTCGCCGTAGAACTTCTGGCCCGACGACCCCGTGCAGAACATGTAGAAATACTGCGCCAGCACCATCACAATATTTTTGTAGAACA
TGTATCCGGCCAGAATGGCCATGCGCTTGTAATTCAGACGGCCGTGGTGCAGCAGCAGCTTCTCCAGGAAGTAAAACTGACCGATAGCGTAGTCACTAGA
GTTCACAGCCTGCATACCTTCCTGGCCTGAGATACCCACACCAACATGCGCGCGCTGAATCATGGCAACATCGTTGGCACCGTCGCCGATCGCCAACGTT
CGCACCTTCTTGTTTGTAGTTCGTACTAACGTCACCACCTCAGCCTTCTGGCTGGGCGACACTCGGCAGCACACCACAGCCTCGCAAGCCATAGCCAGCG
ATAAAAACTCGTGTTGACACCGCTCATCTGCCAGCGTCAATTCCAAACATTCGCCATCAATCACTACAGCGTGGCGACCGCCACCCCGCTGCACCTGTGA
GTTCGCCTCCGAAAGGTGAGTGAAGATTGCGTCCTTGGTCGGGTACAACTCGCAGTTGAAGACAAACTGCTGCATGTCGTTATCCATGAGCTGGCACGCG
TAAGAAATGTTAATCGCAGTTTCCTGCTTGTCACCCGTAAGCATCCAGACTCGCATTCCAGCGCGCATAAGGTTGGCAATGCAGCTGGGCACATTGTTCT
GCAGCTTGTCTTCGATAGCCGTAGCACCAAGCAGCTCCAAGTCATGCTCGATCTCTGTCATCAGCTTGTCGATCTCGTTCGGCTGGCCGTTCTTGCGCTT
GTCAATCTCTTCCAGAGACGAGTTTGCCTCCTTGAAGCGCACGCTCCAGTTTAGGTACTCCTTTTCGTCCACGCGACGCTGCGCGATCGTAAGCGTACGC
AGACCGTCGTCACCAAAAGTCTCCAGATGACGCATTGTCTCCTTCAGCATCTCCGGGTCACTCTTAGCCTTGGCCAGCATGGGGTAGATCACATTGTCCG
CACCCTTCGTCAGTACCCAGTATTCTCCGTTAGGATACTGCACAACGACCGACATACGCTTGCGGTCACTCGTGAACTCCAGAACGTCCAGGATCTGGAA
CTCCAGCAGCACATTTGAGCCAGTGACGCCATTTGCGTAGCGTCGGATCAATTCCGGACTCTTCACGCGCACACGAGCCACACCCAGACCGCGGGATTCG
AAGCTGAAGCCGAAGAACTTTGCGCCTGACACGAGCGCCTGTTCATCCGGCGATGAGGCCGAGAAGCGCACCTCGGAGGTGCCTTCCACGGCCTCCGGGA
TAACTGTCTGGCACAAACTCAGGTGGAGGAAAAACTCGGCCTCACGGTTCGGCGTATCGTCGCTGATAGGACGCTCCAACGCGTTAAACAGCCGCGCGTC
CTCGAAATTGACGTACGGAATCTTGGTGCGACGCGACGCCTGGTCCGGCTCCGCTTCCGTTGGCACAGCGACGCCCTTACGACGCAAGGCAGCACGTCCA
ATTTCCGTCATACCTGTGCCGTACGACACGCCGTTGATGGAGCACTTGCGGAACTCCATCACGTTACAAGTGAGCGTGCCCGTCTTGTCGCTGAACACAT
AAGAGATCTGGCCCAGCTCCTCGTTCAGTCCCATGGAGCGCACAATCATGCGCACGTCCGCCTCCTCGTAGTACATGTCCAGGTCCCAGGTCATGAAGAT
GGCCTGGATAAACATCACCATCGAGATGGTCACGTACAGCGACACGGGGATCATCTGGTACATGAGCAAGAAGTAGTAGCCGAAGCCGACAAACCACTGG
CTCGAGATGCTGGGCGACCAGCTGAGGTACCAGCTATCGTCGATGTTGCTGTTGAGCCAGATGACCTGCACGGTCGTGGCGATGATGCACAAGAAGCACA
GCAGCAGGAACAGCCAGATGATCATCTTGTTGACCGTCTCGTTGATGGAGCTCCACTTGGGGCGCGTGGCCGCCGCGCTCTGCATGATCTTCGTGTCGGG
TCCCGTGTTCACCACGAGGCCGTAGATCCAGTCCGTGTTGCGTAGCTGGCAGCCGCGCAGCAGCACGTTCTTGATGGCGATGGGCTGCGGGTGCGCCTCT
GAGACCTTGGTGCCTTCCGAGACGGACAGCGTGCCGTCGAAGCGGCCAATGGCCTTGTTGGGGTTCTCACAGCGCAGCTGGCCGGCGAGCGCCGCGACTT
GCGCCGCCGATTGCACGTGCAGCGTGGGGTCGCACGCGTGGCGCAGCTTGAGGTTCGTCTCTCCGTCCAGACTCTTGGTCTCGACGTAGCAAATGCCCGC
GGGTTCGCTCGGGTTGGGCTCTGAGACGGCGAGGATGAGCAGGTCGGCGGGGGCCGTCTCCCGGTTGTGTAGCTTGACGACAGACCCGACGGTGAGCGCG
GCCCAGTGCATGAGCGCGATGTCCGGGTCGTCCACGCCGCCCGCGCGGTGCAGCGCGTCGCTTGGGCCAGTGAACGTTTCCTTGAGCACGTGGCACTGGG
CCGAGTTGGCCTCCTTGTCCGCGAGGTGGCGGCGGCGGTCCTCGATCACGGCCAACACGCCGTCCACGGCCAGGATGAACACGAGCACGGGCAGGTTGGA
GGGCAGGCCGTTGGTGTTACTGATACTGGGGATACACTGTAGCACGGAGACCAGCAGAAAATAGGCGTTGGCCAGTTTGCGGAAGCTCTCGAGCATGAAG
AGCGGCAGGAAGTTCCACGTCGTGTACTTGGACGTGATCACCACGTT