Description :
From Genome Similarity Track
Location :
Scaffold_170:89260- 94998
Transcript NameFunction/comments
g6178.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g6179.t1hypothetical protein

Sequence
5738 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACACGCACTAAGGAATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGT
AACACCTTTCTACCAATTAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCATTTTTAGGAGGAAACC
GCATTTACAATCAATACAGTTCTCATTTAGCACCAAAGCTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTA
AGTAAATCACTCCTACGCTTCCTCATACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGAC
TAACACGTTCGTATGGAATACGAACGCGGGGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGC
GTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCT
ATCACCGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGC
GTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTGCGGCTCGAC
GTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGCACGCCGACTCACAGACCCTACGTG
CTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAACAAGTGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAG
GGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCA
TGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGTGTTTAG
CCTGCGGCAGGCTAAACTGCATGTGAACGTCCCACGGCTGATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCG
ACAGCTGCTGGTTCCCAGCAGCGTGGTGGATCAACGAATGTGCGTTGTTTCCGATGCGGAAACATCGGTCCCTATGCCCGCGAGTGCACAGCACCTGTGC
ACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAAAGGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGCGATC
GAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTACAAGAAGCAAGATGACAAGCCGAACCTTGTCATCC
TGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGACTT
CGACGAGGTAGAAACACCTCGAAGTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCTTAC
GAAGAGATGGAGTTCGTCGACGAGCTTATCGTCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTGA
TCGACTGGATGAAGCGCACGATCGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCGCGTGGTGCATG
CGGCCCTCCACCAGAGACAGCGCGGAATGCGGCTGTCTCCGATCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGGAGAAGATGTGAACCGAAT
CAGCAGGGCCTGGTTCAATCCGATTCGAGAGGGTCTCGAAGCGTCCGGAGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGATCGAAAGAC
ACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCTGCACCGGAGATGCT
TGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAACCCGCCGGCGAATTCAAA
GAACAACTGTCCACGGCCGGGCCTGGACAGGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGCAAAGCTGCGCAAGTCTC
GGTCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGG
TCTCCAATACAAGAAGATGAGGCTGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTG
CACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCTGACG
CCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGACGT
ACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCAACAGTGG
CCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCCTA
CGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACCGGCACAGACGCCGATGCCTCGAAA
AGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCT
CTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGTCTGAAGAACGCCCCAGCGATGTTCAACAGGTGCGTCACGC
ACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGGAAATCGGACGTGGAGATGCATAC
AGAGCATCTCCGCAAGCTGCTTGAGCTCATGCGAAAGCACAAGCTCTATGCAAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGG
TGTCTCGTTGGGAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAAATGTAAAGGAACTGCGGCAGTTCC
TTGGACTCGCCACGTACTTGTGCAAGTACGTGAGCAACTACGCGGGCAAGATTCGCACGCTGTCGCAGCTCTTAAAGAAAGAGGCTGCATGGGAATGGAC
TGCTGATTGTCAGCAGGCCTTTGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCACCCATTCCACGTGGTGTGC
GATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAAATCGATCACGAAGGTCGTGATCGCGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTG
AGCGCAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTA
CACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTT
GAGTACAAACCTGGAAGGTTGATTGTCGTGGCCGATGCGCTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGCCGACCACACCCTCGTCGTCCTTGCTG
GATGACGTGAAGGCCACATACGCACATGATGCGGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAAC
ACCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTAGACGACAACGCAGATCGCATTGTCGTGCCGGATGATCA
TGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGACATACTTGCTTCTCACGCGTGACTTCTAC
TGGAGTCACCAGTACAAATGGGTACGCAAGTACGTTCGTGCTTGAGAGGTATGCCAGCGTGTGAAGCCTGCGAGGCTCCGCTTCAATCACTACCGACCCC
GTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATAGTGGTCTTTATTGACCGCTTCAGC
AAGATGGTGCATCTTGCTGCAGTACCAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGGATGCCACTCG
ACATCGTGTCGGATCGGGATCCGCGCTTTACAGCGCGATTCTGGCAAGAAGTGTTTAAACTTCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCC
GCAGACCGACGGACAACCAGAGCGTGTCAACCGCGTGTTGGTTGAGACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATG
GCGGAGTTCGCCATCAACAACTCGGTGCATGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTG
CGGTAGCTCCTTCCTTAAGTTGGGGAGGGTATCCGGTTAATTCGAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGT
ACGTACTGCGCGCAGTCATGGCGACAACAAGACAGTGTCTACGACGGGCGTAGACACTTCAAGCAACAACGAACATCACGCGCAGGCCGGGCCTGCTGCG
AACAAGGAGCACGAACTGAACCAGGGGTTCAGCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAG
CTTCTGTCGATCGACAGAAGATGAATGCCGATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCT
AGCTAAACATGCAGTTTCGATTTCGGAGCAAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGACGAAGCATGGCAACGCGTACACACTGG
ACATACCGTCCAGCATGCGCTTGCACCCAACGTTTTAC