Description :
From Genome Similarity Track
Location :
Scaffold_149:89244- 91618
Sequence
2374 bases(100 bases per row)
AACGGTGACATACCGATCGAGGAATGGACACATCTGTTGTACGCGAATTCGGCGAGATGTAGGTATTCATCCCAATCATTCTGGAATGGGTTCACGACAC
CTCGTAGATAGTCTTCAATAAACCGATTAGTACGCTCGGTCTGACCATCCGTTTGCGGGCGGAAGGCGGACGACAAGTTATGAGTCGTCTCTAATGTCTT
AATCACCTCCTGCCAGAACTTTGATGTCAATTTCGAGTCACGGTCTGAGACGATCGACTTCGGCACTCCATGGTCTTTCACATAATTGGCCATGAATAGG
GCAGCAGTCTCTTCTGCTGTCGCCGCCGTGCTCGTGGCAATGAACTTAGCACGTTCGTCAACCGGTCCAAAATAACCATAATGGCGTCTTTTCCGGCTGC
CGTCTTCGGTCGTGCAACCATGAAGTCCATCGTCACATCAATCCATCTGCCTCCTGGAATCTTCAACGGTTGAAGTAGCCCGGCAGCTTTGTTTGGCGTG
CCTTGTTTCGCTGACAAAGCTCGCACGTGTTCACATAACGCTGAATGTACTTCGACATCTTGGGCCAGTAATATTTCTTCTGGACGCCTAAGTATGTCTT
GAAGTATCCGGGGTGACCTGCCGTGACCACATCGTGGTTTTCACAAATAACACGGTTCTTCAGATCTTCATTGTCCGGAATCACCAGTCGAGCATTTTCA
TCATCTCTCGTTTGGTAATACAGCAGTCCATTCTTCACAGAGTAGCGTGGTACCTCTTTACAACTAGCGATACTCTGCAACAGCTCCTGAACTCTTCGGT
GTGTAGAGTACAGTTGTTTGGCCGAGTGCGTCACAGTTGCACTGGTCCTTTGGACGCTAGCTACAATTTCACGGTTTCGAGCCGCTTCAATGAGCTCACT
GAGACTAACCTGAGCGGCTTTGTGCTCAAAGAGTGGGTTTCGAGACACTGCATCCGACACTTGGTTACTGTCGCCTGGAATCCATTTGAACTGTGGTTGG
AACTCGGTTAGTTCATTAAACCAGCGAGCCACACGACGGTTTGTTGTCTTCTGCGTCAATATAGTCTCAATACTCTTGTGGCCTGTCTCCACCGTAAATG
GCCGATCGAGCAGGTAGACTCTCCACACCCAAAGTGCATGCATAATAGCCAGCAATTCCTGTTCGCGCACTGGGTAGTTTAGCTCCGCTGGTTTCATTTT
ACGACCAGTGAATGCGATCGGATGCTCGAGCCCTCCCTCGTTCTGAAACAAGACCCCCCCTATGGCAAAGTTCGAGGCATCCATACGAATACCGAACGGT
TTTTCGAAATCAGGAAGTTGCAACACGGGAGGGGTGGATAGACGGCGCTTGAGTTCATGAAAACATTCCAACTGGTGCTCAGACAAATGCAGCGTTTCCT
TTGGGCGCAAACCCTTAGTACTTTCATGCAATGGTCCTGCGAATTGCCCGAAGTCGGCGCAAAAGCGCGAGACATAGACCGTAGTACCCAAGAAGCTTTC
CATTTGCTTCTTTGTCCGTGGAATCGGCCACTCGCGAATCACACGCACTTTGTCAGGGTCCATTCGAACACCATTGCGGCCCACAAAATCACCAAGACAA
GGGATCTCTTCGACACAAAACTGGCACTTTGACAACTTGACATACAGATGCTGCTCTTGACAGCGTTGGAGTACTCTGTCCAACGCTTCGACATGCGTCC
GAACAACTGTGTCTTGAGTGAAAACATAGATGTCATCAAAGTAGATGCGCATGACATCGCGTAGGTCGCTAAACACACGCTGTAACAATCGGATAAAAGT
GCCAGGACTACCGCTCAAACCCATAGGGGTGACAAGATACTCAAACAGCCCATCGGGCGTCGAAAAAGCAGTAAATGGAATGTCAGATTCACGAAGTTTA
ACCTGGTAATATCCCCACAAGAGGTCCATGCAGGAGAGCCAGTAACTACCCCCCATTGCGTCGAATGTGTCTTCCTTCCTCGGCATGGGTATGGCCGGCA
AAATGGTAGAGCTGTTGAGCTGGCGATAGTCGTGCACAATACGCCAACCCACGGGTTTCTTGACACAAAAAGTTGGGGCACTGAATGCCGAGGTGCTAGG
GCGAATGATTCCAGCCTGTACCATCTCCTTCGTCCAATCTTGGATGACCTTGCGCTGCTCTGGGCTTTTGCGCCACTGTTTCACCGAAATCGGTTGCGTT
CCCGGCTGAAGCTGAATTTCGTGCTCAATCCCTTCGCGGACAGGAGGTGTGGGACTCGGCAGCTTAGTGCGAAACACAGTATCGCGGTACTTGAGGAAAA
CTTCATATGCCGGATTGTCCGCTAGCCCCTCCCATCCTTGTTGCTTAAAACGCTCAGCCTTTTCTGAGTCGTGC