Description :
From Genome Similarity Track
Location :
Scaffold_19:89241- 104238
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10191dynein light chain
Phypa_INRA-310PPTG_10192hypothetical protein
Phypa_INRA-310PPTG_10193transmembrane protein
Phypa_INRA-310PPTG_10194hypothetical protein
Phypa_INRA-310PPTG_10195hypothetical protein
Phypa_INRA-310PPTG_10196katanin p60 ATPase-containing subunit A
Phypa_INRA-310PPTG_1019730S ribosomal protein S28e
Phypa_INRA-310PPTG_10198hypothetical protein
Phypa_INRA-310PPTG_10199hypothetical protein
Phypa_INRA-310PPTG_10200isochorismatase
Phypa_INRA-310PPTG_10201hypothetical protein

Sequence
14997 bases(100 bases per row)
GAAGGCTACGGCTTCGACATCAGCTACCAACAGCGACACATGCTGTATCTGTACGTGGGCGAGATCGGCGTGCTCGTGTACAAGTGCTGAGTCGAAGATT
ACCACACCGAGCAGATATTGGGATTTTTCAATCTAGTGCTTCAACGTACTCTTCTTCTTTTCTTGACTATTGTACTTGTGCACCTTTTGTGCCTGCGAGA
GCTTATAGATGTGGACTTCTCGTTTTGCTACTAACTACGTCGAACAGTCATCACCTGTCTGCCACTTGGTCGAGACACGAACGGATTCAACTGCATTACA
CTGTGTCTACTTTGCCTGGGTACTTGGTCGGTAGCTCCAGTGTCTGCTTCGGCATCGGGACCACTGCAGTGCGCCGGTCCATGTCTTCCATGGCCTTGAC
GAATTCCTTGCTCTCCAGCTCCATGAATGGCAGTCTGAAGCGCTGATTTCTCCTGCTTATGTCGTCCTGAGCCTTATCATGTATCTTATCGAAGAATCCG
CGAGTTTTGAGTGATAGTAGCAGGCCGCAAACCAGGAACAGACCGGCGTACAGGCCTCCTACGAGGTAGCAGTTGATTTCAGCGTTGCTTGCGCTCGTCT
GCAGTCCGTGTACATAGTGTGGCTGGAAACGGAACAGCAGACCGAAGACCGGCATGAGCAGCATTCCCGCTGCAGACAAAGCCATCGCGATGCGCAGATG
ACTACTTTCTAAGCAAGTCATGACACTATTGTGTCTCTTCCTCCTCGTCCACTTCGAGAAGTGAGCTCTTGAAACGAACATTCATCTTCCAATGGACCAA
TCACAGCGCCGCATTATGTACCCATCCCATATCAGTGTTGCAGTTTTGATCGATTTCAGTGTCCTATTTTGCTTTTCATTTCTCGTATGTTGCTGCAGGG
ACCCTCGCCCAATGCTCTCAGCAACTTTGGCAAAGTTCGTCAATTGCTCTACGCGCGTGTGGTGGCAGGTGCCTTGTGATCACGGAAGCTCTTCAGCTCG
GCGAGTCGCACGAAGCGGTGGTAGATGAGCGGGTGTAGCTGGCTCAGTCGTCCCGGGTTCTCGGCGAAGCATACGAACAGCGTCTTAATGACCGCCGCAA
TCACTTGTGTGGCCAATGAGATGGTCGTGTAGCAAAGCGTGAAGGCCACCAACGTGAAGAACGTCGCGTGGGACGATGCACCAGCCAGAGCCGACGCTGT
CAACGCGCTCATGACGCCAGCCCAGCCATTGCCGCCAAACAGCAGGATGCGGCTGGTCAGATCGTCGTCCACAATTGCTTCCACGCCGTGATGCTCGATC
AGCTTCCAGGCGTCGTGTGCTGCCACGTAATAAGGCTTGTTGTAGCCGGCAATGTGCACAAAAGCATACTTGTGATACGTGCGGATGAAGTGCTCCACTC
GCTCCGAACGCAGCGACATAAATCGTCGCGAGAGAATCGATTCGTCTCGTCGAGCCCAGCGCAGAGCATTCCACACGAGATGTGCCAGTGGACACAACAA
AGAACCGATGCAAATGGAGCCAAATGAACTCGACATGGCGCAGCGTGCGTAGTGCAGCACTACTTTCCGGTCAAGATAATCGGTGCTTGTGTCTTGCTGT
GTTTGGTCATTGCCGTCGCCATTAGAGGCATCGTCCGAGATGTTGTCGCGAATGTCTGGCGAGATCTCAGTCGATTCATTGCGGTAGTACCAGATCATAG
TCGTGCCGGAAGCCACAATCGTTATGATGTTCTTAAACACATTGGACATCCAGTAGAAGTGGAAGACCAGGTAGATCATCGAGAAGCTCCAGGGTGACAC
CTCTCGTCCAACATATCCGATCGTCGTGCAGATCCAGCTGGCCCATACAGTGTAGGCCACAAGTACGACACATGTAGCGTATCCAAGAGCCGAGTGGGTC
ATCAAGAACTCGACGACCAACTCGAAGAAGACTGCCACGAAGTCCAGGCCGTGGTTCGAGCGTACGTACCACACCAGGTCCATTACCACGACGCCCGTGC
ACATGATACCCCAGAACATACCATTACTGGACTCGAGCAGGAAAAGCATGACCGCCAGAGCCGACAGTCCAGCCATGGAGAAGATACACGAGCCCTGCAC
GAAGCGCAGCTTGGAGTAGAAAATAAATAGCAGCAGCCAGCCCAGAGCGAACAATACGTTCACCACACAGAGCGAGCGTAGCGCCACGCCCACGTCTGCG
TCATCCTGTCCCACGCTCGAGTCGTCCTGCGAGTCCTTCAAACCGCTCACGACTTCGCGGCGTTCCTCTTCGAGTTCCTCACGCTCGCCGTCCGTGCGGA
TACTTCCAGTGGCCAGCAGCATCAGAATCAGATGCAGCACGAATAAACCTGCGAATGGCACGTCCCGGAACATAAGCGGTGAGTGCAGCGACGGCAACGG
GCGATCGCCACTGGCTGAGTCCGTCATGGACAGCGGGATGAGCTTCGAGGCAGACGCCAAGTCGTAGTCGGCGTTGTCCTCTTCTTCGCGTTGAAGCGTG
GGGGACAGCGAGAGGTCCTCCATAGCTGCGACCGGGGACGTAGGTACCTCGAAAGGACCATTGGCGTCGTCGATAACGATGCTCGACGGCCGCGACGTAG
GAGTCGCCATCGAGACGCTTACGAGTGCAATGCGGCAGTTGAGCGAATGTTGAGGTTATGCTAAAAATAGGCTTGTCTCTGCAGTATTAAACTGTAAAAC
GGCATATTGCATACTCTGAACCCAGCTGTTGTCGTCATCTCGCACCGCAATTGACGTGGGATTTGTATTGTGGCATACAAACATCAAGTTTAATCGCCGT
CTAGAAGAGACACAACCTCATTCGAGCTCTATCCGACTCGCACGGCGTGATCCTCCTGCCGCCCTAGAGCCCCCCGCCATGGCTAACTTCGACGCCATCG
ACCTGCTGCTACGCTACGAGACGCCTCTCGTCAAGGACATGGAGCCAGATGACGATGTTCTCGAGTGGGTGGCCGCCTATGTGGGCAGCGAGGGCTTCCA
GGAGGCAATTGACAATTTCTGCGGCGCCCACGCGAGTCACTTCTCCATTCTTCTGACCAAGGGAGGACCTTCCGCTGCCGATCTGGACAAAGTCGAATCG
TCAGTATATGACTTCTCTCTGTTGGTCCTGTAGTATACTAAATACTCACGTGATAACACTGTTGCAGGACATGGAAGGAGCTGCACGAGGCATTCATCGA
CACGGCCAACGCCCACATCGAGGCGTTCCTCGTGGAAAGGGGATTTACTATGGACCAGTATAACACCCGCTGCGAAGAGGAGATTGCGCTGTCCGAGGAG
CGACAACGACACACGCGGCTCAGTTTCTTCGTGCAGATCCTGCTGGCCTGTTGCGAGTATGAGCAGTTCCTCAACCTCATGAAGCGCGTGGCCGACCCCG
AGTATTACGACAAGAAGGAGCTGCAGTATGAAGCTGAGAACCTCGTGTACGAGGCCGAGGAGAAGGGAGCCACCAACGCCCAGCGGGCTGCGGGCGCACA
GGCCTTCCTGGACTTCTTCCAGGCCAACCCCGACTTGACGCTGGACGAACTGACGCAGGAATTCCAAAAGAAGATGCAGCTCACGTGAAGTTGGCCCTCT
CTTCGGATGGCTGCACACCTGTTTGTATCATTTAACCATGAGCCCAGTCCAATAGTTACAGTAGACGCACATGTTGCACCCAACTCAACACAATCAGCGA
GGCGGCAGGAGGTCGAGAAGACCGACGCAATAAAGCGAGGCTTCGATTGGAGCAGCCTACCTGTCTACCTGTCCCGCTCTAACAGTAGAAGACAAAGTGA
GATCGAAGTGAAGATCAATGACCCCAGAAAAAAATGGATCCATCTATATGTTGAAGTTGTTGGAACTGAACGAGCTCTTGTCCTCAGACAGAAGCACCAC
GTCGAGCAGCGGTGTGTCTGAGTGGAAACAGCACACCAATTCGACAATATCTTGGCATTTGATCTCTGTACGAGGCTTCTCAGCGACGTCCAAACTCGGT
AGCAGTCGAAGAAGATCCTGCCAAACGAGTTCTTGGAACCGAGCACGAACATTGACACTAGATATCGCTCGACTTGATACAGAGCTACTGACAACGTCTT
CGTGGCAGTCTTGGATTGCTTGGTTGAGATACAGTTCTCGAATATCGTCCAGTGTTAGACTCCTCTCCAATGAATTTGAACTTCCATGTTGATGTAGAAA
TGAACGAAGCGCCTCTTGTCCATGTTGTGATGATGCCACGTTCTCGTATAGCTGCAGGAAACTCGTGATGTCGCCTTCGGACAATTCATGTTTTCCTTCT
CTGTCGAGACAGTCAAAAACTAGTTGCAGGTTGGCATCAACCGAGGCTGGAGTCAGTGCAGCATTTTCTGCTTTAGAACGTGATTCAGGGAGCTTTGCTG
ATACTGTCACGACGTATTCACCAGCACTAAGAGTTCTCACCACCTGACGTAAGGTACAAAGCATCGTGAGGCGGCGCATTAGCTCTTAATTCGAGCACGT
CTTACCTGCTTACTGGAGACTCCGTCATCACTCTCTGATAAATCTTGAAACTTGTTATTATTTTCCATCAACGCGAGCGAAAAATCACTCTCCACTGTTA
CCACATTCACATCCACGTCCACCTGTTGATCGCAGAACTCGGTAGTGAAATGAAGCAAATACAAGGACGAGAAGGTGATCGTCGTTAGAGTTGGTACACT
GATGACTGCTGTCATCGTTCCGATATCCTCTTCGTGAAGAAGTATCCGTCTTAATCGTTGTTCGCATCGTCGACCCAGAGGGAGGGACCACACAGCAGGT
TCCAACTCGAAAAGCTGCTCCCAGGATACACGAAGTGCTGAGGGATCTTGGTCACGGTCAAACTCTGCAATACTGTCTGCAATTTTTTGCCGCAGATATT
TTCCGGTAGCGTCGTGCAGAACTACTGAAGTTGTAGATGAGTCTTCGTCGCTTGAAATCGTGAGCCGAAATGCTCGATGATGATTGTCAAGCTTTCCGCA
TGTTACAGCAACCAGCAAAGACACTTCATCGGATTTTGGCCGATAGGATTGCGTGGCTTGTATAACCTCTTGAAGCCGCATTTTCCCGGTGGATGGATCT
GTATCATTCTCATAATCTTGTCGACGATAGCAATAAACCCTGCGCCAGAAACGTATTAGCGAGCGGATAGAGTTTTGTTCAATAAATAAAAAAAATCGGC
GTACCAAGGAGATCCAGTCAACTCTCGAAGAATCTTCATCGTCGGAATGTTGGAGACTGCTGCATAACTTCCTTTCAATTTTGCGTAAGCTTTGTGGAGG
AGAGCTGGATACCAATCTCCGAAAATGTTACGTGGTGTCATGAGACCTCGTCCAAGTGGGAAGGAAGGAAAGAAGAGATCAACAGCTAGATGCTGCCATG
TTAGACCTCGGTCGCAGAGTGCCACCGGGACGGCAGCCACTTTGTCAAATTGACCAGAAGTATCTAACGTAGGAAACCATTGATGAAGCCATAGTTCATA
ATGCGGAGCAATGATCGTCAGCGCACAAAGGAACGAGTCTTGGGCGGGGAGACCCGAAGTAAATGCAACAGTCGAGGCAGAGTCGTGAGCAACAAAAGTC
CATGATGAGTCGATGATGTTGTGAATGAGGTCCCAAGTGCAGAGCGAGTAGATTGCAGAATCGGCTTCCGATACTTTGTTTGGAGCATCAGTGTCATAGA
GAGATTTTGCTTGTGGAGGAAAACTCATATCGACAAATACGTCTCCAAATTCTCGAAAGTATCGGTTGATTTCATCGCAGGCTCGGATAACTTCAGCTGC
AGGCCGATACGGCAGAGTTTGCCACTTACCGACGTGGCTGAATATGTGGTTACTATGCTGCTGTTGCTTCAGAATCATTCTTGCTGCTCTCTCTTGGGCT
TCAAGAATTGCGTCCACAGAGGGCGTGACCACTGCAGTCACCGCGTAATGGACACGCACAAGTGCTCGCTGTTTTCCTTTCTTAATCACGTACGCGAGCA
CTCGTCGCTCAAAGGGGCGGAGCTCGCAGTTGAATGCCAATTGTTGTGTTGCCTTCTGCTGAGTAGTGGAACCTGGTTCGGCAGGACGGTGAAGCTGAAT
GTTTGCCGACTCGCTGAAGTCAACTTGAAACGTGACAACATCGAAACCAGAATTCTCCGCAACGTACTGAAGTGCGGTGGTAGAAGCGGTGGTCCCGTCC
GGCTTCGGAGCTCGCGCCTGAAGCTCACGCTGTGTCACGAAGACTGTTACATGGTCGTGAAGTTTCTGCATCGTTCACCCGCGCACCAGCACCTCACCAG
AAGATTCGAATATCCAAGTATGCGTCTCTTCAAGATCGAGTAATGGTGAGTTTGGGTTGGGGGACTGTGGAAGTGCAAGGACATAACGATGCGGGTAATG
ATCAAACATTTGAAGCCCGATCGATCTGAGCAATTCTTCGTGAGTTTGCGCTGTTGCAAGCGACCTCGACTATTAATACGAAACGAAAGTGTCAGTATCT
AGAGTAGTTCACAACCCGTCACCATGAGCTCGCTTGTGCAGCTTAAAGCACAGAACGAAAGCCGACTGGCGGTATGCTACTTTACTTCTCAGCTCTGGTA
CGCAGGGGTTTGTCTAACCGATGCAATTGCAGGAAGAGAAGCGGCTGATTGATCGTCGACGGAACGTCCTCGTCATGATGCTGCAGCATTGTACGGAGAA
TGGGTATCTGCAAACAGCCGAAAAGCTCCAGCAAGAGGCAGGTGTCGCTCTCTCCAAGTTCGAAGTTGTCGAGAACATCGATCTGCTGCGTATCGTACAA
GTGCGTCAAACTCATAACGCTTAGTTGCGGGCCTTATCTATGACAATTACTATGTCGCATTTTAGGAGTACGAAGATTTCCAAGAGATCAAGTTCGGTAA
ACGCCCCAAGCTAGTTCGCCGCTTATCGCCTGATGAACAGGACAGAGCGCGGTCAGCTAACGACAAGAAAGCAGCAGCTACAGCCAAACGGGCGCGACGT
AATGAGTATACATCGCCAAACATGCCAACGGAAGCGCGAGTGGAGAATAATGTTGCGATGCGAGTCGTCCACAACAGCGCCAACAACGCTAGTAATGTAG
CTGCTTCTAGACCTACTAAAGAAGCAAACCAGGCTCGAAACGATGATTCAGCCGTTGATCTCGGACTCGTCGGACAAAAGCCGGCACAGAATCAGACTCG
CAATTCCAAGTCCGGCGTCTCAAAGAAATCCCAACCAACAGATGAGCAGCAACACGAAGAGAGTGTAGAGGAACGACTTTTAAAACCTTTGTCATCCTTT
GCTTACGACTTGGAACTTCGACCATTAGCGGAGACTATCACACGCGAGATCTACCAAAAGAACCCGGACGTCCGGTGGAACGATGTCATCGGTCTACAGG
AGACCAAACGGTTGTTGAAAGAGGCTGTCGTCATGCCACTCAAATATCCGCAGTTGTTCCAGGGCTTACTCTCACCCTGGACTGGCATCTTGCTCTATGG
TCCACCTGGAAATGGCAAGACGATGCTGGCCAAGGCTGTGGCGACTGAGTGTCGAACCACTTTCTTCAACATCTCCGCCTCGTCCATCGTGAGCAAGTAC
CGAGGTGACTCGGAGAAGCTCATTCGGATGTTGTTCGAGCTAGCGCGACATCACGCGCCATCCACGATTTTCTTGGATGAGATCGACTCGATTATGGGCC
AGCGAGATAGTGGAGGAGGAGGCCAAGAGCACGAGGCTAGTCGTCGCATGAAGACTGAGCTGCTGATCCAGATGGACGGTCTCACCAAGACTGACGACGT
TGTCTTTGTGCTAGCAGCCAGTAATTTACCATGGGATCTAGACGCTGCGATGCTGAGGCGGCTTGAGAAGCGCGTGCTAGTAGATTTACCATCAGCAAAG
GCTCGACAGGCACTCTTCGCCTCGCTGCTGGAGCCCTATACGCCAAACACCTTCGACTTTAACGAGGCTGTGAAGCTGACAGAGGGGTACTCTGGCACTG
ATATTAAGCTAGTAGCGAAAGAAGCCTGTATGGCACCTGTGCGCCGGTTGATGGAGAAATTGGAGGCCACTGATAGCTCTGAAGCTCTTCCTACAGGCAG
TAATCAAGGCCGCGACGCATCTGCAGCGGACTGGAGGGAAATGCTGGGTTATGTACAACCAGAAGATCTTCTTGCAGCACTGCAGAGAACCAAGCCGTCA
GCACAGCAGCTACTAAGGAGATATGAGCAATGGCAGATCAAGTTCGGGTCTACATGAAGGACAACTTCAACTTGTCTGAAAATGAAGCCATTCAAGTCAC
TTTATCGAGGTACAGTAATGAATGACATCCATTTCAAGCGCGCTTGAAAATTCGCGCTTAAGTGTTGGCACTGCATTTCCTTCGTACAACCTTCGCACAA
CCATCCAGATCAACCGCCCGCCGCCAGTCGTTAACAGCGCCAGCCGCACCACTCCTCGCATACTACTGCACTACCTCATCGACATCTAACGCAAAAATGG
TAAGCGAACAGGTCCTTTCCAGGCATGTGCGCGCGGTAACTGTTGGAGCGTAAATACGACGCATACATGTAGAGCCGACGCGTGCGTTTCTGCTCCGACT
TTCTCCGCGAGCAGCGGACGCCTAGAGCGCGAGCAATCACAGGCTAAAGTCGAGCGATCCGCTACGGGCGTCCAATGCCATGATTATATAGAGAGAGCAA
AGATGACTAACTGGAGATGATGGCTATGACAGGATGCCCCTCGTGACTACATGCTGGCTAAGGTCGTGAACGTCCTCGGACGCACGGGTAACACGGGTAA
CGTGACCCAGGTGCGCGTCGAGTTCCTGCAGGACGACAAGCGTAAGATCATCCGTAACGTCAAGGGACCCGTGCGTGAGGGTGACATCCTGTGCCTGCTC
GAGTGGGAGCGTGAGGCTCGCCGCCTGAGATAAGCGGAGTTAGTCTACACTTCAGCTGCAATAATGAACGAGGAGCGGTGGACACTTTCTACAAGACAAA
CAGGGGCAGCGATGGAGTAACACAGAGCGGACGACTGTTGACAGGCTCCGGGTGATGCATTCATCGTCTTCTTTTTAGTTGTGGAGACTCCGTACTTCGA
TCAGCTTGCAGCGTTCGGATTTCAACCACTTCGTTACGGACTGGGAGAACCGGAAAAGGGGACGAGGACGTAGGCCGACTTAATTCGCGGTAATATTTCG
ATGAGAACAAACGCGCCCGTTGTGTATTGTACGCTGCACTTGTTGGACATTCTCGTCTTGCTTGGTATTGCAGGAATTATGGGTACTGTTACAAGCAGGG
TCACAAGACGACAGCGTTCACCTTGCGGGGCGCTCATCTGGTTGTAAGAAATCGATACTGGGCTTCGCATCTTGTTGATACGTTATCGCTTTTACGAGGC
GAACTACATGTATGCCAGATGCACCATGAGAGCATTATACTGCCACTTACCTACTCTACTCTACTCCTCTTCAGCCATTATCGATTTTCACCAGCCAAGC
ACGAATTGATCCAGCCTGCAACGAGGCATATGCTCAACGAGACGCATGTTCACCGATGTGCAAGTTCAACGAGAACTGTCGACTTTACGCTGATACCGGC
GCCACTACTCGCTGCTTTACTGCTGATCTTCAGATAATACGAAGCTGGAGAGCGGTCGCCACTGCTCCTACCTTTATACACATTCCCACACGTTGATGAT
TTTGTCAATGCCCCCCGAAATAATCAGTGGGAGACTCGGGTGGACGTCCAGGCATGTCACGAAGTGGCTGTGAGCCTCATCAAGCGTCCGCACGCAACGA
CCAGTCTGCACAAATAAAAAAACGTCAGACCACTAATAAACACATTAAACCGAGTCAAACTTACGTCAACGTCAAAGACGCGGATGGTCTTGTCTTCACC
GGCGCTGAGCGCGTACTTGCCGCTAGGGTGGAAACGAACTTCGCGCACCCAGTTCTCGTGACTAGCGAACAGCATCAATTGCATGCCGCTGAAGGCTTCC
CATAGACGCACTGTGCGGTCACGAGATCCAGACAACAGGAACTTCATGCGGCGGACAGTAGGCACACTGGCGACAGCGACTGCACCAGTGGGTTCTCCTG
CCGTACTGTCGGTCATGTCATGGTTGTTAGCCTCCGGAGAGGCGACTCCATTGGCTGGAGTCAGTGCTCCCGTAGCCGCAAGCTTCTTGGAGTGAATCTT
CTCAATAACCTGCTCTTGTCCTGTCTTAGCGAACACCACACTCTCCACGACATGTTCGTGCTCGCGGATAGACTGCAACACGCGCATGTGTTGTAGATCC
CAGAACAAAATCGATCGGTCGTTGCCGCAGGAAGCCAAATACAGCCCGTCGTCACTGACTGCCACATCCCGCACCCAGTCGGTATGTCCAGCATTCAGCG
TGTTGACACAGTAGCCTGTGGATAATTCCCACACTTTGATAGTGTTATCACGCGAGCACGAGTACAGTCGGTCGCTTGCAAGGTCGGGGCCGAACACGAT
GCCACAGACATTGTGGTCATGTCCGCGTAAGGTGCGAAGACACTCGTAGTCGCCATCACTGGAGAAATCCCAGATCTTAACGGACAGATCTGTGGATGTG
GAGGCTAATAGTGATCCAGAACCGTTGAAGGCCACAGCCTGTACGGGGTTTGTGTGGCCCTTAAGTGTGCGCTCGTACTCGCCCGTCTCAAAGTCCCAGA
CCTTGACGCTGGCATCCTCACTGCCCGAGACAAGGACGCTGAAGACAGGGTGGAAGGCTACGCACGTGATAGGTGAGCGGTGGCCTGTTAGTGAGAACTT
GGCGGGTGCGCGTGGCAGAAACTCGGTACGTTGGCGGGCGCCCAGCACGTCTCTACGGCTAAGCACACCGCCTAGTTTGGCGTTCTCCTCGAGCTGCACC
ATCTTCGTCTCGAGCTCCATGACCTTGCGCTGTAGACGGATCACGGATGTCCACTTCTTTTCCAGTAGACCGGCGTGTTTGCCGTCGCTCGACTTGGTCA
CGTCCGCTTCCTTCTCGAAGGCGGCGGCAGTGTCGGCGAAGCGCTCGCCCATACCCACGAGGTAGTCGAGCATGGCCTGATGGCTGCAGAAAACATTAGA
GAGGGAAGGGAATAGGTGTGTGGACTTTCATATACGTACAGATCCTGGCGCTGCTTGTCCGTGAGCACCATGGCGCGGAGGGAGGCTGGTCTAATTGTAA
GACGCTCGCTGCTTTGAAGACAGAAAAAGCTAACCACGAAGGAGGCACTCAAGCGGGGCTCTAACTCCAAAGAGTGACGTGAACATGGCTTTGAGCAGCA
TTGTTGAAGTAGTCCAAAAACCAATGCAGATTGCTGTGAACACTCACGGTTACAGGAGGCTCAGGCGAAAACATTCTCAGCGTAAGTGCAATAAACTCAG
ATCGGTGGTGCAGTTCGGCGCTAGAGCAAACTGGCCAACAGCTTACACCGTTTACTTTTGCTTGTTTCAGGGGCGCCAAGCCTACTTTTTTGAAGTGCTT
GGTCACCACTGCGCATCGCGCTAGTCGTAAACAACAGCAAAGCGATACTGTATTGAGGCTTCATTTCATGGAAACTTGCTAGAAAACGGCACCAATGCTG
CGCTTGGAACGTTCGTACATGTACATCGACGATGTAACATCGTTGCATTCCTGATCGTATGGACGAAGGATCTACTGTACGACTTGTTGTTGGTAAGATT
TTTCAAGGCACTCCGACTGGCGACATCTGTCTGAAGTTCTTCTGTACAACACAGAGAGCCTGCACCGAGAGCGATCGCAGATTACACTGCTCAATAAGAA
GAGAGCCTTCGGCTACGCTGCGCCAATGCACCAAGAAGGTCGGAGCACAATGCTGTCCTGGCAGATTAATTAGCAAAGTCCACAATGATAAAGTGTCATC
GACACATTATTGTAATACATATCTCGGAGGGGTACAATAAGGCTTTGCCAGCGCTTCCTTCTTGTTCGTCAAGAAGACGATGTTTCGTCGTTCTTGACGG
ACAAGACAAGCATGCGTTACCAGTGGTTCAACGAGGCGATGCCGCATTTTGTGGAGGAGGCAGGTCCAGTCGAGCGTGGCTTGCATCGGCACACTGTCGA
CAACAGCGATGCCGCGCTTTTGTTGTTCGCGCCGCGTACACAGCTGGCGATTACAGAAAACATGAGACTTTGGCAGAGATTGAAAATCACTTGTTCTGAG
TATGCCGATCCTGTCACTGCCGTTTCTGAGTTTAGTGGAGACGAAGATGAAGGGGACAGTGCACTGATGCCTGGTGCTTGTATCCAGTCGATCATGTGGC
GCTGGCGTACACGTATGCCACGCTCCCTTGTGATGTCGATCCTTCTGGTTGATTAACGTGGGTGTCCGAGCGCAGGTGGAACTCCACAGCCTCATTCATC
AACTTTCCCGCCGGCACAACTATCACTATGGTTCGTCTTGCTGCTTTTGCCGGAGCTTCCGCCGCGGCGCTCGCTTCTACCAACGCCTTCACGGTAACCA
TCACCAACGGATGCTCCAGCCCCATTGACCTGTACACGCGCCTCGCCAGCGTCTACACCGACGAGAGCGATACCATCGCCCCTGGTGCCTCGATCGACAA
GACTATCGAGAAGGGATTCGAGGGACACTTCCGCAATGGCTCAAGCGATGCCGCCACGCTCATTGAGTTCGCCACAAAGGGCGACCTCGATCTCGCTTGG
TACGATATCGGTATCATCCCGCCGCACCTCAACCCCGGCTACGAGTACTGCTCGAGTCTGCAGGAGTGCAAGGACCACTCCAAGAGCGGCATCGGCTTCA
ACACTCCCGTTCAGGTGACCCCTACGTCGAACACGGGCAAGGACACGTGCGAGCAGATCGAGTGTTTGGCGGACGCTTGCGAGGACGCCTACAACTACCC
TAAGGACGACACCAAGACCCACTCGTGCGCGTTCGGCACGGACTTCGTCGTGACCTTCTGTCCGTCCGGTGACGCGTCCCAGACGCAGCAGACCACGTCG
GGATCGGCCTCGACCACGCAGGATGCCGCTCAGCAGGAGACCACACAGGAAGAGACTCCCGCTCCTGAGACGACTGCACCGGCCGTGACGGAGGCCCCGG
CTACGGATGCCCCAGTGCAGGAAGCATCAGCCGCCTCGGACAGCGGTGCCGGTAAGGTGCACACCCAGGACGAAGGAGTGAATGGCGAGTCGCAGACTAC
GGCTCCGGAGGTGACTGAGGCCGAGACACCCGCCCCTGAGGTGGTTCAGACTGAGACACCTGCCCCGGAGGTGACCCCCGCGTCCACCCCGGCCGCCACC
AAGTCCAAGTACTGCGTGTAAGGAAGCCCTGTGTACGTTCTCGACTGAATCAGGTCGAACAATTTTCCAGCTGTCCATAGCGTAGATGAAACTTAGAAAT
TCACCGCTCATCCTGTACACTACAGCTCCTCCTTCTTCTCTTTCATCTCAACGTCAGCCACAGTGGTTTTATTAAGTTGATGTCATCAACTTGTCAAACT
GTTTGACTACTGTAGTTTGAAACAAACAAAACACTCCTGGTCAACATTGTGGGGTTTTAGCCAATCACTGGTCTCCAAATCGGAGTGTTGAACTTGGCCC
TCATTCTTCAATCGGAAACGCAAGCTAATCGACGACGACAGAGATGGCTCTGAGCACGGCAACCAAGCATCTGGGACGGTTGCTGCCGCAGTCCAGCGTC
CTCTTTGTGTGCGACGTGCAGGAGGTCTTCCGCGGCCTCACATTCCAGTTGCCCACGGTTATCCATGGCACCAACACGATGGTAGGCGACAGCGTGAGAT
CTTCCGCCTCTATACAAAACCTGTTCTAACTTTGCGTGCTACTCCTCCAGGTATCGGCAGCCAAACTCCTGAATCTACCAGTGGTGGTGACGACCCAGTA
TGGCTCCCGTTTGGGCAGCACCGTGTCCGAGATCTCCCAGAACTTGAAGGACATGAACGACGTCAAGACCTTCGACAAGATGAAGTTCTCCATGCTCGTG
CCTGAGGTGGAGCACCACCTGACCTCCAACATGCCGCAGCGCAAGTCCGTGCTGCTCTGCGGTATCGAGACGCATGTTTGTGTCCTACAGACATGCCTCG
ACCTGCTGGATAAGGGCTACGATGTGCACGTGGTCTCTGACGCCGTGTCCAGCTCCACGAGCTACAACCGCTCCATGGCTCTCGAGCGCATGCGCCAGTC
TGGTGCCTTCATTACGTCTGTCGAGTCGGCCATCTTCCAGCTGGCCAATGACGCCAGCAACCCCGAGTTCAAGAGCATCTCCAAGCTCATCAAGGAACAT
CTCCAGGTGGAGAACGGATTCGACACTGGGGCCCGTATCTAGGTCAGCAAAACACGTGAGTCGAGAGCAGAAGACAACACGAAGCGTGTGTACTTGTGTG
CATTTCAGTGATCAACAATTATTTTCAGGTTTGTTTCTGGAAGAAGTCGAATAAAGTTTTCTTGCCAGCGCCAGGTGCCGCCTTGTGAGCGAGTGCTTGG
GCTTTCCTAGCACTGTTAGCGACAGGTTTCACTGCTGGACGTGGCCTCTTTTTAGACTTGGGGTTGAGCTGCGTTTGCGGTATGATTTTCGCACTGGGTG
CTTGACCTTCAGGAGACTTTGACGCGTGAGAGGACTGCGAGTGCTTTGCGACGAGATCTTTCATCGATGTCGCAGTGACCTTCGACGTCACTACTGTTGC
TGTACTTGACAGTATACGAGTTGAAGGAGCAGGAGTTGATCCGGCCTCGTCTTGTTTCGAGTCTGTCATTCGTGTCCGAGTTGCAGACGTCAGCCACTGG
GAGGCAGAAATTGTTGATGCTGGAGTGGCTTTGTAGGCACTCACTAGTCCTCGAATGGATGCTGCGCGTTCCTGTGCCTGCAAGCGCTTCTTGTTCTCAA
GTTGTTGAGCCACCACTTCTGGCTTGCTCACCTCTCGGTGTGTTACCGTTGTGCGAAAACCATGCTCCGCATTACTCGATGGTTCTCCAGGGTGTTG